PSMC5 cloning plasmid

• Catalog number
  CSB-CL018895HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PSMC5 gene.
• Specifications
  Gene name: PSMC5; Gene ID: 5705; Accession number: BC001932; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1221; Sequence: atggcgcttgacggaccagagcagatggagctggaggaggggaaggcaggcagcggactccgccaatattatctgtccaagattgaagaactccagctgattgtgaatgataagagccaaaacctccggaggctgcaggcacagaggaacgaactaaatgctaaagttcgcctattgcgggaggagctacagctgctgcaggagcagggctcctatgtgggggaagtagtccgggccatggataagaagaaagtgttggtcaaggtacatcctgaaggtaaatttgttgtagacgtggacaaaaacattgacatcaatgatgtgacacccaattgccgggtggctctaaggaatgacagctacactctgcacaagatcctgcccaacaaggtagacccattagtgtcactgatgatggtggagaaagtaccagattcaacttatgagatgattggtggactggacaaacagatcaaggagatcaaagaagtgatcgagctgcctgttaagcatcctgagctcttcgaagcactgggcattgctcagcccaagggagtgctgctgtatggacctccaggcactgggaagacactgttggcccgggctgtggctcatcatacggactgtacctttattcgtgtctctggctctgaactggtacagaaattcataggggaaggggcaagaatggtgagggagctgtttgtcatggcacgggaacatgctccatctatcatcttcatggacgaaatcgactccatcggctcctcgcggctggaggggggttctggaggggacagtgaagtgcagcgcacgatgctggagttgctcaaccagctcgacggctttgaggccaccaagaacatcaaggttatcatggctactaataggattgatatcctggactcggcactgcttcgcccagggcgcattgacagaaaaattgaattcccaccccccaatgaggaggcccggctggacattttgaagattcattctcggaagatgaacctgacccgggggatcaacctgagaaaaattgctgagctcatgccaggagcatcaggggctgaagtgaagggcgtgtgcacagaagctggcatgtatgccctgcgagaacggcgagtccatgtcactcaggaggactttgagatggcagtagccaaggtcatgcagaaggacagtgagaaaaacatgtccatcaagaaattatggaagtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PSMC5   cloning  
• Gene symbol
  PSMC5
• Short name
  PSMC5 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  proteasome (prosome, macropain) 26S subunit, ATPase, 5 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  proteasome (prosome, macropain) 26S subunit, ATPase, 5, p45 and p45/SUG and S8 and SUG-1 and SUG1 and TBP10 and TRIP1, PSMC5 and IDBG-63742 and ENSG00000087191 and 5705, thyrotropin-releasing hormone receptor binding, nuclei, Psmc5 and IDBG-213426 and ENSMUSG00000020708 and 19184, PSMC5 and IDBG-641700 and ENSBTAG00000021061 and 282015

Gene info

• Identity
  HGNC:9552
• Gene
  PSMC5
• Long gene name
  proteasome 26S subunit, ATPase 5
• Synonyms gene name
  • proteasome (prosome, macropain) 26S subunit, ATPase, 5
• Synonyms
  • SUG1
  • p45/SUG
  • TBP10
  • p45
  • S8
  • TRIP1
  • SUG-1
  • RPT6
• GenBank acession
  • L38810
• Locus
  17q23.3
• Discovery year
  1995-12-08
• Entrez gene record
  5705
• Pubmed identfication
  • 9473509
  • 9048938
• RefSeq identity
  • NM_002805
• Classification
  • Proteasome
  • AAA ATPases
• VEGA ID
  OTTHUMG00000179013

Similar products