COL2A1 cloning plasmid
-
Catalog numberCSB-CL005739HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the COL2A1 gene.
-
SpecificationsGene name: COL2A1; Gene ID: 1280; Accession number: BC007252; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 807; Sequence: atgtccgcctttgctggcttaggcccgagagagaagggccccgaccccctgcagtacatgcgggccgaccaggcagccggtggcctgagacagcatgacgccgaggtggatgccacactcaagtccctcaacaaccagattgagagcatccgcagccccgagggctcccgcaagaaccctgctcgcacctgcagagacctgaaactctgccaccctgagtggaagagtggagactactggattgaccccaaccaaggctgcaccttggacgccatgaaggttttctgcaacatggagactggcgagacttgcgtctaccccaatccagcaaacgttcccaagaagaactggtggagcagcaagagcaaggagaagaaacacatctggtttggagaaaccatcaatggtggcttccatttcagctatggagatgacaatctggctcccaacactgccaacgtccagatgaccttcctacgcctgctgtccacggaaggctcccagaacatcacctaccactgcaagaacagcattgcctatctggacgaagcagctggcaacctcaagaaggccctgctcatccagggctccaatgacgtggagatccgggcagagggcaatagcaggttcacgtacactgccctgaaggatggctgcacgaaacataccggtaagtggggcaagactgttatcgagtaccggtcacagaagacctcacgcctccccatcattgacattgcacccatggacataggagggcccgagcaggaattcggtgtggacatagggccggtctgcttcttgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCOL2A1
-
Short nameCOL2A1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namecollagen, classification II, a 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetcollagen, type II, alpha 1, ANFH and AOM and COL11A3 and SEDC and STL1, COL2A1 and IDBG-29355 and ENSG00000139219 and 1280, platelet-derived growth factor binding, Extracellular, Col2a1 and IDBG-179337 and ENSMUSG00000022483 and 12824, COL2A1 and IDBG-632928 and ENSBTAG00000013155 and 407142
-
Gene info
-
Identity
-
Gene
-
Long gene namecollagen type II alpha 1 chain
-
Synonyms gene
-
Synonyms gene name
- collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)
- arthroophthalmopathy, progressive (Stickler syndrome)
- collagen, type II, alpha 1
- collagen type II alpha 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1986-01-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Collagens
-
VEGA ID
-
Locus Specific Databases