FAM19A1 cloning plasmid
-
Catalog numberCSB-CL770353HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FAM19A1 gene.
-
SpecificationsGene name: FAM19A1; Gene ID: 407738; Accession number: BC025746; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 402; Sequence: atggcaatggtctctgcgatgtcctgggtcctgtatttgtggataagtgcttgtgcaatgctactctgccatggatcccttcagcacactttccagcagcatcacctgcacagaccagaaggagggacgtgtgaagtgatagcagcacaccgatgttgtaacaagaatcgcattgaggagcggtcacaaacagtaaagtgttcctgtctacctggaaaagtggctggaacaacaagaaaccggccttcttgcgtcgatgcctccatagtgattgggaaatggtggtgtgagatggagccttgcctagaaggagaagaatgtaagacactccctgacaattctggatggatgtgcgcaacaggcaacaaaattaagaccacgagaattcacccaagaacctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTAFA1
-
Short nameFAM19A1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namefamily including sequence similarity 19 (chemokine (C-C motif)-like), member A1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetfamily with sequence similarity 19 (chemokine (C-C motif)-like), member A1, FAM19A1 and IDBG-43758 and ENSG00000183662 and 102724799,407738, Extracellular, Fam19a1 and IDBG-171964 and ENSMUSG00000059187 and 320265, BT.66729 and IDBG-645075 and ENSBTAG00000019041 and 782935
-
Gene info
-
Identity
-
Gene
-
Long gene nameTAFA chemokine like family member 1
-
Synonyms gene
-
Synonyms gene name
- family with sequence similarity 19 member A1, C-C motif chemokine like
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2005-01-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- TAFA chemokine like family
-
VEGA ID