P2RY2 cloning plasmid

• Catalog number
  CSB-CL017334HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the P2RY2 gene.
• Specifications
  Gene name: P2RY2; Gene ID: 5029; Accession number: BC028135; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1134; Sequence: atggcagcagacctgggcccctggaatgacaccatcaatggcacctgggatggggatgagctgggctacaggtgccgcttcaacgaggacttcaagtacgtgctgctgcctgtgtcctacggcgtggtgtgcgtgcttgggctgtgtctgaacgccgtggcgctctacatcttcttgtgccgcctcaagacctggaatgcgtccaccacatatatgttccacctggctgtgtctgatgcactgtatgcggcctccctgccgctgctggtctattactacgcccgcggcgaccactggcccttcagcacggtgctctgcaagctggtgcgcttcctcttctacaccaacctttactgcagcatcctcttcctcacctgcatcagcgtgcaccggtgtctgggcgtcttacgacctctgcgctccctgcgctggggccgggcccgctacgctcgccgggtggccggggccgtgtgggtgttggtgctggcctgccaggcccccgtgctctactttgtcaccaccagcgcgcgcgggggccgcgtaacctgccacgacacctcggcacccgagctcttcagccgcttcgtggcctacagctcagtcatgctgggcctgctcttcgcggtgccctttgccgtcatccttgtctgttacgtgctcatggctcggcgactgctaaagccagcctacgggacctcgggcggcctgcctagggccaagcgcaagtccgtgcgcaccatcgccgtggtgctggctgtcttcgccctctgcttcctgccattccacgtcacccgcaccctctactactccttccgctcgctggacctcagctgccacaccctcaacgccatcaacatggcctacaaggttacccggccgctggccagtgctaacagttgccttgaccccgtgctctacttcctggctgggcagaggctcgtacgctttgcccgagatgccaagccacccactggccccagccctgccaccccggctcgccgcaggctgggcctgcgcagatccgacagaactgacatgcagaggatagaagatgtgttgggcagcagtgaggactctaggcggacagagtccacgccggctggtagcgagaacactaaggacattcggctgtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  P2RY2   cloning  
• Gene symbol
  P2RY2
• Short name
  P2RY2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  purinergic receptor P2Y, G-protein coupled, 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  purinergic receptor P2Y, G-protein coupled, 2, HP2U and P2RU1 and P2U and P2U1 and P2UR and P2Y2 and P2Y2R, P2RY2 and IDBG-63697 and ENSG00000175591 and 5029, G-protein coupled purinergic nucleotide receptor activity, Plasma membranes, P2ry2 and IDBG-201761 and ENSMUSG00000032860 and 18442, P2RY2 and IDBG-635267 and ENSBTAG00000039050 and 282638

Gene info

• Identity
  HGNC:8541
• Gene
  P2RY2
• Long gene name
  purinergic receptor P2Y2
• Synonyms gene name
  • purinergic receptor P2Y, G-protein coupled, 2
• Synonyms
  • P2U
• GenBank acession
  • U07225
• Locus
  11q13.4
• Discovery year
  1995-10-20
• Entrez gene record
  5029
• Pubmed identfication
  • 8159738
  • 9286708
• RefSeq identity
  • NM_176072
• Classification
  • P2Y receptors
• VEGA ID
  OTTHUMG00000167966

Similar products