CLDN4 cloning plasmid
-
Catalog numberCSB-CL005506HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CLDN4 gene.
-
SpecificationsGene name: CLDN4; Gene ID: 1364; Accession number: BC000671; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 630; Sequence: atggcctccatggggctacaggtaatgggcatcgcgctggccgtcctgggctggctggccgtcatgctgtgctgcgcgctgcccatgtggcgcgtgacggccttcatcggcagcaacattgtcacctcgcagaccatctgggagggcctatggatgaactgcgtggtgcagagcaccggccagatgcagtgcaaggtgtacgactcgctgctggcactgccgcaggacctgcaggcggcccgcgccctcgtcatcatcagcatcatcgtggctgctctgggcgtgctgctgtccgtggtggggggcaagtgtaccaactgcctggaggatgaaagcgccaaggccaagaccatgatcgtggcgggcgtggtgttcctgttggccggccttatggtgatagtgccggtgtcctggacggcccacaacatcatccaagacttctacaatccgctggtggcctccgggcagaagcgggagatgggtgcctcgctctacgtcggctgggccgcctccggcctgctgctccttggcggggggctgctttgctgcaactgtccaccccgcacagacaagccttactccgccaagtattctgctgcccgctctgctgctgccagcaactacgtgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCLDN4
-
Short nameCLDN4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameclaudin 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetclaudin 4, CPE-R and CPER and CPETR and CPETR1 and hCPE-R and WBSCR8, CLDN4 and IDBG-20463 and ENSG00000189143 and 1364, identical protein binding, Cell surfaces, Cldn4 and IDBG-203317 and ENSMUSG00000047501 and 12740, CLDN4 and IDBG-648717 and ENSBTAG00000026278 and 414921
-
Gene info
-
Identity
-
Gene
-
Long gene nameclaudin 4
-
Synonyms gene
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1998-04-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Claudins
-
VEGA ID