PPP2R4 cloning plasmid
-
Catalog numberCSB-CL620876HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PPP2R4 gene.
-
SpecificationsGene name: PPP2R4; Gene ID: 5524; Accession number: BC002545; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 972; Sequence: atggctgagggcgagcggcagccgccgccagattcttcagaggaggcccctccagccactcagaacttcatcattccaaaaaaggagatccacacagttccagacatgggcaaatggaagcgttctcaggcatacgctgactacatcggattcatccttaccctcaacgaaggtgtgaaggggaagaagctgaccttcgagtacagagtctccgaggccattgagaaactagtcgctcttctcaacacgctggacaggtggattgatgagactcctccagtggaccagccctctcggtttgggaataaggcatacaggacctggtatgccaaacttgatgaggaagcagaaaacttggtggccacagtggtccctacccatctggcagctgctgtgcctgaggtggctgtttacctaaaggagtcagtggggaactccacgcgcattgactacggcacagggcatgaggcagccttcgctgctttcctctgctgtctctgcaagattggggtgctccgggtggatgaccaaatagctattgtcttcaaggtgttcaatcggtaccttgaggttatgcggaaactccagaaaacatacaggatggagccagccggcagccagggagtgtggggtctggatgacttccagtttctgcccttcatctggggcagttcgcagctgatagaccacccatacctggagcccagacactttgtggatgagaaggccgtgaatgagaaccacaaggactacatgttcctggagtgtatcctgtttattaccgagatgaagactggcccatttgcagagcactccaaccagctgtggaacatcagcgccgtcccttcctggtccaaagtgaaccagggtctcatccgcatgtataaggccgagtgcctggagaagttccctgtgatccagcacttcaagttcgggagcctgctgcccatccatcctgtcacgtcgggctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPTPA, LINC01503
-
Short namePPP2R4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprotein phosphatase 2A activator, regulatory subunit 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprotein phosphatase 2A activator, regulatory subunit 4, PP2A and PR53 and PTPA, PPP2R4 and IDBG-89032 and ENSG00000119383 and 5524, protein phosphatase 2A binding, nuclei, Ppp2r4 and IDBG-156714 and ENSMUSG00000039515 and 110854, PPP2R4 and IDBG-639691 and ENSBTAG00000001933 and 514460
-
Gene info
-
Identity
-
Gene
-
Long gene nameprotein phosphatase 2 phosphatase activator
-
Synonyms gene
-
Synonyms gene name
- protein phosphatase 2A, regulatory subunit B' (PR 53)
- protein phosphatase 2A activator, regulatory subunit 4
- protein phosphatase 2 regulatory subunit 4
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1994-06-09
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Protein phosphatase 2 modulatory subunits
- Cyclophilin peptidylprolyl isomerases
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namelong intergenic non-protein coding RNA 1503
-
Synonyms
-
Locus
-
Discovery year2014-08-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Long intergenic non-protein coding RNAs
-
VEGA ID