CCRL1 cloning plasmid
-
Catalog numberCSB-CL865095HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCRL1 gene.
-
SpecificationsGene name: CCRL1; Gene ID: 51554; Accession number: BC069438; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1053; Sequence: atggctttggaacagaaccagtcaacagattattattatgaggaaaatgaaatgaatggcacttatgactacagtcaatatgaactgatctgtatcaaagaagatgtcagagaatttgcaaaagttttcctccctgtattcctcacaatagttttcgtcattggacttgcaggcaattccatggtagtggcaatttatgcctattacaagaaacagagaaccaaaacagatgtgtacatcctgaatttggctgtagcagatttactccttctattcactctgcctttttgggctgttaatgcagttcatgggtgggttttagggaaaataatgtgcaaaataacttcagccttgtacacactaaactttgtctctggaatgcagtttctggcttgtatcagcatagacagatatgtggcagtaactaaagtccccagccaatcaggagtgggaaaaccatgctggatcatctgtttctgtgtctggatggctgccatcttgctgagcataccccagctggttttttatacagtaaatgacaatgctaggtgcattcccattttcccccgctacctaggaacatcaatgaaagcattgattcaaatgctagagatctgcattggatttgtagtaccctttcttattatgggggtgtgctactttatcacagcaaggacactcatgaagatgccaaacattaaaatatctcgacccctaaaagttctgctcacagtcgttatagttttcattgtcactcaactgccttataacattgtcaagttctgccgagccatagacatcatctactccctgatcaccagctgcaacatgagcaaacgcatggacatcgccatccaagtcacagaaagcatcgcactctttcacagctgcctcaacccaatcctttatgtttttatgggagcatctttcaaaaactacgttatgaaagtggccaagaaatatgggtcctggagaagacagagacaaagtgtggaggagtttccttttgattctgagggtcctacagagccaaccagtacttttagcatttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCX3CR1, ACKR4
-
Short nameCCRL1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-C motif) receptor-like 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-C motif) receptor-like 1, CCRL1 and IDBG-57099 and ENSG00000129048 and 51554, chemokine binding, Plasma membranes, Ccrl1 and IDBG-255670 and ENSMUSG00000079355 and 252837, CCRL1 and IDBG-647339 and ENSBTAG00000019577 and 281672
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-X3-C motif chemokine receptor 1
-
Synonyms gene
-
Synonyms gene name
- chemokine (C-X3-C) receptor 1
- chemokine (C-X3-C motif) receptor 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-01-12
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C-X-3-C motif chemokine receptors
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameatypical chemokine receptor 4
-
Synonyms gene
-
Synonyms gene name
- chemokine (C-C motif) receptor-like 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-02-18
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Atypical chemokine receptors
-
VEGA ID