MAP3K3 cloning plasmid
-
Catalog numberCSB-CL013425HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the MAP3K3 gene.
-
SpecificationsGene name: MAP3K3; Gene ID: 4215; Accession number: BC010464; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 273; Sequence: atgaatgaagcaaatgtcatgctgccttattcagggaaggaggagcctgtcctgcctgtggccatgaccctgcctctcccaggcaggggcccgcgatgtggaactgctgccactgaggggggatccagttttgtcaatgcagttgtctctgttttacaagttggagtcactcttatgctgtacccagtttctaaactggagactgtgtgtgccctctgggctctgagtacccctgctttgggcttgggcctaggctgcattgaaaagagctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolMAP3K3
-
Short nameMAP3K3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namemitogen-activated protein kinase kinase kinase 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetmitogen-activated protein kinase kinase kinase 3, MAPKKK3 and MEKK3, MAP3K3 and IDBG-63432 and ENSG00000198909 and 4215, transferase activity, Cytoplasm, Map3k3 and IDBG-213345 and ENSMUSG00000020700 and 26406, MAP3K3 and IDBG-641597 and ENSBTAG00000008151 and 508943
-
Gene info
-
Identity
-
Gene
-
Long gene namemitogen-activated protein kinase kinase kinase 3
-
Synonyms gene
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-11-14
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Mitogen-activated protein kinase kinase kinases
-
VEGA ID