SERPINE2 cloning plasmid

• Catalog number
  CSB-CL021082HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the SERPINE2 gene.
• Specifications
  Gene name: SERPINE2; Gene ID: 5270; Accession number: BC042628; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1194; Sequence: atgaactggcatctccccctcttcctcttggcctctgtgacgctgccttccatctgctcccacttcaatcctctgtctctcgaggaactaggctccaacacggggatccaggttttcaatcagattgtgaagtcgaggcctcatgacaacatcgtgatctctccccatgggattgcgtcggtcctggggatgcttcagctgggggcggacggcaggaccaagaagcagctcgccatggtgatgagatacggcgtaaatggagttggtaaaatattaaagaagatcaacaaggccatcgtctccaagaagaataaagacattgtgacagtggctaacgccgtgtttgttaagaatgcctctgaaattgaagtgccttttgttacaaggaacaaagatgtgttccagtgtgaggtccggaatgtgaactttgaggatccagcctctgcctgtgattccatcaatgcatgggttaaaaatgaaaccagggatatgattgacaatctgctgtccccagatcttattgatggtgtgctcaccagactggtcctcgtcaacgcagtgtatttcaagggtctgtggaaatcacggttccaacccgagaacacaaagaaacgcactttcgtggcagccgacgggaaatcctatcaagtgccaatgctggcccagctctccgtgttccggtgtgggtcgacaagtgcccccaatgatttatggtacaacttcattgaactgccctaccacggggaaagcatcagcatgctgattgcactgccgactgagagctccactccgctgtctgccatcatcccacacatcagcaccaagaccatagacagctggatgagcatcatggtgcccaagagggtgcaggtgatcctgcccaagttcacagctgtagcacaaacagatttgaaggagccgctgaaagttcttggcattactgacatgtttgattcatcaaaggcaaattttgcaaaaataacaaggtcagaaaacctccatgtttctcatatcttgcaaaaagcaaaaattgaagtcagtgaagatggaaccaaagcttcagcagcaacaactgcaattctcattgcaagatcatcgcctccctggtttatagtagacagaccttttctgtttttcatccgacataatcctacaggtgctgtgttattcatggggcagataaacaaaccctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  SERPINE2   cloning  
• Gene symbol
  SERPINE2
• Short name
  SERPINE2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor classification 1), member 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2, GDN and GDNPF and PI-7 and PI7 and PN-1 and PN1 and PNI, SERPINE2 and IDBG-82303 and ENSG00000135919 and 5270, heparin binding, Extracellular, Serpine2 and IDBG-173051 and ENSMUSG00000026249 and 20720, SERPINE2 and IDBG-644187 and ENSBTAG00000008717 and

Gene info

• Identity
  HGNC:8951
• Gene
  SERPINE2
• Long gene name
  serpin family E member 2
• Synonyms gene
  • PI7
• Synonyms gene name
  • serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2
  • serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2
• Synonyms
  • PN1
  • GDN
  • PNI
  • nexin
• Synonyms name
  • glial-derived nexin 1
• GenBank acession
  • M17783
• Locus
  2q36.1
• Discovery year
  1994-09-01
• Entrez gene record
  5270
• Pubmed identfication
  • 7665170
  • 24172014
• RefSeq identity
  • NM_006216
• Classification
  • Serpin peptidase inhibitors
• VEGA ID
  OTTHUMG00000133163
• Locus Specific Databases
  • LRG_645

Similar products