AP2S1 cloning plasmid
-
Catalog numberCSB-CL001873HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the AP2S1 gene.
-
SpecificationsGene name: AP2S1; Gene ID: 1175; Accession number: BC006337; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 429; Sequence: atgatccgctttatcctcatccagaaccgggcaggcaagacgcgcctggccaagtggtacatgcagtttgatgatgatgagaaacagaagctgatcgaggaggtgcatgccgtggtcaccgtccgagacgccaaacacaccaactttgtggagttccggaactttaagatcatttaccgccgctatgctggcctctacttctgcatctgtgtggatgtcaatgacaacaacctggcttacctggaggccattcacaacttcgtggaggtcttaaacgaatatttccacaatgtctgtgaactggacctggtgttcaacttctacaaggtttacacggtcgtggacgagatgttcctggctggcgaaatccgagagaccagccagacgaaggtgctgaaacagctgctgatgctacagtccctggagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAP2S1
-
Short nameAP2S1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameadaptor-related protein complex 2, sigma 1 subunit cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetadaptor-related protein complex 2, sigma 1 subunit, AP17 and CLAPS2 and FBH3 and FBHOk and HHC3, AP2S1 and IDBG-59076 and ENSG00000042753 and 1175, protein transporter activity, Plasma membranes, Ap2s1 and IDBG-146794 and ENSMUSG00000008036 and 232910, AP2S1 and IDBG-639941 and ENSBTAG00000010584 and 536553
-
Gene info
-
Identity
-
Gene
-
Long gene nameadaptor related protein complex 2 subunit sigma 1
-
Synonyms gene
-
Synonyms gene name
- hypocalciuric hypercalcemia 3 (Oklahoma type)
- adaptor related protein complex 2 sigma 1 subunit
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2000-09-01
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Adaptor related protein complex 2
-
VEGA ID