PPP1R1A cloning plasmid

• Catalog number
  CSB-CL613409HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PPP1R1A gene.
• Specifications
  Gene name: PPP1R1A; Gene ID: 5502; Accession number: BC022470; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 516; Sequence: atggagcaagacaacagcccccaaaagatccagttcacggtcccgctgctggagccgcaccttgaccccgaggcggcggagcagattcggaggcgccgccccacccctgccaccctcgtgctgaccagtgaccagtcatccccagagatagatgaagaccggatccccaacccacatctcaagtccactttggcaatgtctccacggcaacggaagaagatgacaaggatcacacccacaatgaaagagctccagatgatggttgaacatcacctggggcaacagcagcaaggagaggaacctgagggggccgctgagagcacaggaacccaggagtcccgcccacctgggatcccagacacagaagtggagtcaaggctgggcacctctgggacagcaaaaaaaactgcagaatgcatccctaaaactcacgaaagaggcagtaaggaacccagcacaaaagaaccctcaacccatataccaccactggattccaagggagccaactcggtctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PPP1R1A   cloning  
• Gene symbol
  PPP1R1A
• Short name
  PPP1R1A cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  protein phosphatase 1, regulatory (inhibitor) functionnal sequence 1A cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  protein phosphatase 1, regulatory (inhibitor) subunit 1A, I1 and IPP1, PPP1R1A and IDBG-38169 and ENSG00000135447 and 5502, protein binding, Extracellular, Ppp1r1a and IDBG-189917 and ENSMUSG00000022490 and 58200, PPP1R1A and IDBG-631049 and ENSBTAG00000010907 and 767949

Gene info

• Identity
  HGNC:9286
• Gene
  PPP1R1A
• Long gene name
  protein phosphatase 1 regulatory inhibitor subunit 1A
• Synonyms gene name
  • protein phosphatase 1, regulatory (inhibitor) subunit 1A
• GenBank acession
  • U48707
• Locus
  12q13.2
• Discovery year
  1993-01-22
• Entrez gene record
  5502
• Pubmed identfication
  • 8611507
• RefSeq identity
  • NM_006741
• Classification
  • Protein phosphatase 1 regulatory subunits
• VEGA ID
  OTTHUMG00000169934

Similar products