TRIAP1 cloning plasmid

• Catalog number
  CSB-CL024443HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the TRIAP1 gene.
• Specifications
  Gene name: TRIAP1; Gene ID: 51499; Accession number: BC002638; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 231; Sequence: atgaacagtgtgggggaggcatgcacggacatgaagcgcgagtacgaccagtgcttcaatcgctggttcgccgagaaatttctcaagggggacagctccggggacccgtgcaccgacctcttcaagcgctaccagcagtgtgttcagaaagcaataaaggagaaagagattcctattgaaggactggagttcatgggccatggcaaagaaaagcctgaaaattcttcttga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  TRIAP1   cloning  
• Gene symbol
  TRIAP1
• Short name
  TRIAP1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  tumor protein p53 regulated inhibitor on apoptosis 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  TP53 regulated inhibitor of apoptosis 1, TRIAP1 and IDBG-60567 and ENSG00000170855 and 51499, phosphatidic acid transporter activity, Cytoplasm, Triap1 and IDBG-193728 and ENSMUSG00000029535 and 69076, TRIAP1 and IDBG-634788 and ENSBTAG00000012790 and 100851493,525164

Gene info

• Identity
  HGNC:26937
• Gene
  TRIAP1
• Long gene name
  TP53 regulated inhibitor of apoptosis 1
• Synonyms
  • P53CSV
  • WF-1
  • HSPC132
  • p53CSV
  • MDM35
• Synonyms name
  • p53-inducible cell-survival factor
  • mitochondrial distribution and morphology 35 homolog (S. cerevisiae)
• Locus
  12q24.31
• Discovery year
  2006-02-24
• Entrez gene record
  51499
• Pubmed identfication
  • 11042152
  • 15735003
• RefSeq identity
  • NM_016399
• VEGA ID
  OTTHUMG00000047787

MeSH Data

• Name
  Radioimmunosorbent Test
• Concept
  Scope note: Radioimmunoassay of proteins using antibody coupled to an immunosorbent.
• Tree numbers
  • E05.478.566.380.830
  • E05.478.566.639.830
  • E05.601.470.380.830
  • E05.601.470.639.830
• Qualifiers
  ethics, mortality, psychology, trends, veterinary, history, classification, economics, instrumentation, methods, nursing, standards, adverse effects, statistics & numerical data

Similar products