TAGAP cloning plasmid
-
Catalog numberCSB-CL818676HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TAGAP gene.
-
SpecificationsGene name: TAGAP; Gene ID: 117289; Accession number: BC015859; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 801; Sequence: atgaagctgagaagcagccacaatgcttcaaaaacactaaacgccaataatatggagacactaatcgaatgtcaatcagagggtgatatcaaggaacatcccctgttggcatcatgtgagagtgaagacagtatttgccagctcattgaagttaagaagagaaagaaggtgctgtcctggccctttctcatgagaaggctctcccctgcatcagatttttctggggctttggagacagacttgaaagcatcgctatttgatcagcccttgtcaattatctgcggtgacagtgacacactccccagacccatccaggacattctcactattctatgccttaaaggcccttcaacggaagggatattcaggagagcagccaacgagaaagcccgtaaggagctgaaggaggagctcaactctggggatgcggtggatctggagaggctccccgtgcacctcctcgctgtggtctttaaggacttcctcagaagtatcccccggaagctactttcaagcgacctctttgaggagtggatgggtgctctggagatgcaggacgaggaggacagaatcgaggccctgaaacaggttgcagataagctcccccggcccaacctcctgctactcaagcacttggtctatgtgctgcacctcatcagcaagaactctgaggtgaacaggatggactccagcaatctggccatctgcattggacccaacatgctcaccctggagaatgaccagagcctgtcatttgaagcccagaaggacctgaacaacaaggtttgttctgcttactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTAGAP-AS1, TAGAP
-
Short nameTAGAP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameT-cellular activation RhoGTPase activating protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetT-cell activation RhoGTPase activating protein, TAGAP and IDBG-98525 and ENSG00000164691 and 117289, guanyl-nucleotide exchange factor activity, Cytoplasm, TAGAP and IDBG-635407 and ENSBTAG00000031701 and 509236,784926
-
Gene info
-
Identity
-
Gene
-
Long gene nameTAGAP antisense RNA 1
-
Locus
-
Discovery year2020-09-16
-
Entrez gene record
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameT cell activation RhoGTPase activating protein
-
Synonyms gene name
- T-cell activation GTPase activating protein
- T-cell activation RhoGTPase activating protein
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-07-20
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Rho GTPase activating proteins
-
VEGA ID