PSMA8 cloning plasmid
-
Catalog numberCSB-CL855031HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSMA8 gene.
-
SpecificationsGene name: PSMA8; Gene ID: 143471; Accession number: BC025389; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 729; Sequence: atggcgtctcgatatgacagggcgatcactgtcttctccccagacggacacctttttcaagttgaatatgcccaggaagcggtgaagaaaggatccaccgcggtcggaattcgaggtaccaatatagttgttcttggggtagaaaaaaaatctgttgccaagcttcaagatgaaagaactgtgaggaaaatttgtgcccttgatgaccatgtctgcatggcttttgcagttttgacaatttttataggacttactgctgatgctagagtagtaataaacagagcccgtgtggagtgccagagccataagcttacggttgaggacccagtcactgtagaatacataactcgcttcatagcaactttaaagcagaaatatacccaaagcaatggacgaagaccttttggtatttctgccttaattgtaggttttgatgatgatggtatctcaagattgtatcagacagatccttctggtacttatcatgcttggaaggcaaatgcaataggccgaagtgctaaaactgttcgagaatttctagaaaagaattacacagaagatgccatagcaagtgacagtgaagctatcaagttagcaataaaagctttgctagaagttgtccagtctggtggaagaaacattgaacttgctataataagaagaaatcaacctttgaagatgtttagtgcaaaagaagttgaattatatgtaactgaaatagaaaagtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPSMA8
-
Short namePSMA8 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) subunit, alpha classification, 8 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) subunit, alpha type, 8, PSMA8 and IDBG-1797 and ENSG00000154611 and 143471, threonine-type endopeptidase activity, nuclei, Psma8 and IDBG-129424 and ENSMUSG00000036743 and 73677, PSMA8 and IDBG-643817 and ENSBTAG00000017698 and 614703
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome 20S subunit alpha 8
-
Synonyms gene name
- proteasome (prosome, macropain) subunit, alpha type, 8
- proteasome subunit alpha 8
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2005-01-14
-
Entrez gene record
-
RefSeq identity
-
Classification
- Proteasome
-
VEGA ID