NTF3 cloning plasmid

• Catalog number
  CSB-CL016120HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NTF3 gene.
• Specifications
  Gene name: NTF3; Gene ID: 4908; Accession number: BC069773; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 774; Sequence: atgtccatcttgttttatgtgatatttctcgcttatctccgtggcatccaaggtaacaacatggatcaaaggagtttgccagaagactcgctcaattccctcattattaagctgatccaggcagatattttgaaaaacaagctctccaagcagatggtggacgttaaggaaaattaccagagcaccctgcccaaagctgaggctccccgagagccggagcggggagggcccgccaagtcagcattccagccggtgattgcaatggacaccgaactgctgcgacaacagagacgctacaactcaccgcgggtcctgctgagcgacagcacccccttggagcccccgcccttgtatctcatggaggattacgtgggcagccccgtggtggcgaacagaacatcacggcggaaacggtacgcggagcataagagtcaccgaggggagtactcggtatgtgacagtgagagtctgtgggtgaccgacaagtcatcggccatcgacattcggggacaccaggtcacggtgctgggggagatcaaaacgggcaactctcccgtcaaacaatatttttatgaaacgcgatgtaaggaagccaggccggtcaaaaacggttgcaggggtattgatgataaacactggaactctcagtgcaaaacatcccaaacctacgtccgagcactgacttcagagaacaataaactcgtgggctggcggtggatacggatagacacgtcctgtgtgtgtgccttgtcgagaaaaatcggaagaacatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NTF3   cloning  
• Gene symbol
  NTF3
• Short name
  NTF3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  neurotrophin 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  neurotrophin 3, HDNF and NGF-2 and NGF2 and NT-3 and NT3, NTF3 and IDBG-13412 and ENSG00000185652 and 4908, nerve growth factor binding, Extracellular, Ntf3 and IDBG-190188 and ENSMUSG00000049107 and 18205, NTF3 and IDBG-640643 and ENSBTAG00000010223 and 532393

Gene info

• Identity
  HGNC:8023
• Gene
  NTF3
• Long gene name
  neurotrophin 3
• Synonyms
  • NGF2
• Locus
  12p13.31
• Discovery year
  1991-01-15
• Entrez gene record
  4908
• Pubmed identfication
  • 1889806
• Classification
  • Neurotrophins
• VEGA ID
  OTTHUMG00000168649

Similar products