IL1R2 cloning plasmid

  • Catalog number
    CSB-CL011622HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the IL1R2 gene.
  • Specifications
    Gene name: IL1R2; Gene ID: 7850; Accession number: BC039031; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1197; Sequence: atgttgcgcttgtacgtgttggtaatgggagtttctgccttcacccttcagcctgcggcacacacaggggctgccagaagctgccggtttcgtgggaggcattacaagcgggagttcaggctggaaggggagcctgtagccctgaggtgcccccaggtgccctactggttgtgggcctctgtcagcccccgcatcaacctgacatggcataaaaatgactctgctaggacggtcccaggagaagaagagacacggatgtgggcccaggacggtgctctgtggcttctgccagccttgcaggaggactctggcacctacgtctgcactactagaaatgcttcttactgtgacaaaatgtccattgagctcagagtttttgagaatacagatgctttcctgccgttcatctcatacccgcaaattttaaccttgtcaacctctggggtattagtatgccctgacctgagtgaattcacccgtgacaaaactgacgtgaagattcaatggtacaaggattctcttcttttggataaagacaatgagaaatttctaagtgtgagggggaccactcacttactcgtacacgatgtggccctggaagatgctggctattaccgctgtgtcctgacatttgcccatgaaggccagcaatacaacatcactaggagtattgagctacgcatcaagaaaaaaaaagaagagaccattcctgtgatcatttcccccctcaagaccatatcagcttctctggggtcaagactgacaatcccgtgtaaggtgtttctgggaaccggcacacccttaaccaccatgctgtggtggacggccaatgacacccacatagagagcgcctacccgggaggccgcgtgaccgaggggccacgccaggaatattcagaaaataatgagaactacattgaagtgccattgatttttgatcctgtcacaagagaggatttgcacatggattttaaatgtgttgtccataataccctgagttttcagacactacgcaccacagtcaaggaagcctcctccacgttctcctggggcattgtgctggccccactttcactggccttcttggttttggggggaatatggatgcacagacggtgcaaacacagaactggaaaagcagatggtctgactgtgctatggcctcatcatcaagactttcaatcctatcccaagtga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    IL1R2   cloning  
  • Gene symbol
    IL1R2
  • Short name
    IL1R2 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    interleukin 1 receptor, classification II cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    interleukin 1 receptor, type II, CD121b and CDw121b and IL-1R-2 and IL-1RT-2 and IL-1RT2 and IL1R2c and IL1RB, IL1R2 and IDBG-64053 and ENSG00000115590 and 7850, interleukin-1, Extracellular, Il1r2 and IDBG-148186 and ENSMUSG00000026073 and 16178, IL1R2 and IDBG-630754 and ENSBTAG00000006343 and 515700
Gene info
  • Identity
  • Gene
  • Long gene name
    interleukin 1 receptor type 2
  • Synonyms gene
  • Synonyms gene name
    • interleukin 1 receptor, type II
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1992-11-30
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • CD molecules
    • Immunoglobulin like domain containing
    • Interleukin receptors
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee