AP1S3 cloning plasmid

• Catalog number
  CSB-CL839389HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the AP1S3 gene.
• Specifications
  Gene name: AP1S3; Gene ID: 130340; Accession number: BC021898; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 315; Sequence: atgatacatttcatattgctcttcagtcgacaagggaaattacggctacagaaatggtacatcactctccctgataaagagaggaagaagatcacccgggaaattgttcagattattctctcccgtggtcacaggacaagcagttttgttgactggaaggagctaaaacttgtttataaaaggtatgctagtttatatttttgctgtgcaatagaaaatcaggacaatgagctcttgacgctagagattgtgcatcgttacgtggagctgctggacaaatattttggaaatacttggccttttgcaagagcctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  AP1S3   cloning  
• Gene symbol
  AP1S3
• Short name
  AP1S3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  adaptor-related protein complex 1, sigma 3 subunit cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  adaptor-related protein complex 1, sigma 3 subunit, AP1S3 and IDBG-82268 and ENSG00000152056 and 130340, protein transporter activity, Plasma membranes, Ap1s3 and IDBG-172884 and ENSMUSG00000054702 and 252903, AP1S3 and IDBG-644181 and ENSBTAG00000011133 and 540693

Gene info

• Identity
  HGNC:18971
• Gene
  AP1S3
• Long gene name
  adaptor related protein complex 1 subunit sigma 3
• Synonyms gene name
  • adaptor related protein complex 1 sigma 3 subunit
• Synonyms
  • sigma1C
• GenBank acession
  • AF393369
• Locus
  2q36.1
• Discovery year
  2002-12-17
• Entrez gene record
  130340
• Pubmed identfication
  • 27388993
• Classification
  • Adaptor related protein complex 1
• VEGA ID
  OTTHUMG00000133165

Similar products