ID3 cloning plasmid

• Catalog number
  CSB-CL010969HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ID3 gene.
• Specifications
  Gene name: ID3; Gene ID: 3399; Accession number: BC003107; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 360; Sequence: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtcccgagaggcactcagcttagccaggtggaaatcctacagcgcgtcatcgactacattctcgacctgcaggtagtcctggccgagccagcccctggaccccctgatggcccccaccttcccatccagacagccgagctcgctccggaacttgtcatctccaacgacaaaaggagcttttgccactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ID3   cloning  
• Gene symbol
  ID3
• Short name
  ID3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  inhibitor on DNA binding 3, dominant negative helix-loop-helix protein cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  inhibitor of DNA binding 3, dominant negative helix-loop-helix protein, bHLHb25 and HEIR-1, ID3 and IDBG-93963 and ENSG00000117318 and 3399, protein dimerization activity, nuclei, Id3 and IDBG-197682 and ENSMUSG00000007872 and 15903, ID3 and IDBG-645454 and ENSBTAG00000030425 and 538690

Gene info

• Identity
  HGNC:5362
• Gene
  ID3
• Long gene name
  inhibitor of DNA binding 3, HLH protein
• Synonyms gene name
  • inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
• Synonyms
  • HEIR-1
  • bHLHb25
• Synonyms name
  • inhibitor of differentiation 3
• GenBank acession
  • X69111
• Locus
  1p36.12
• Discovery year
  1994-12-19
• Entrez gene record
  3399
• Pubmed identfication
  • 1628620
• RefSeq identity
  • NM_002167
• Classification
  • Basic helix-loop-helix proteins
• VEGA ID
  OTTHUMG00000003229

Similar products