PSMB4 cloning plasmid

• Catalog number
  CSB-CL018882HU4-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PSMB4 gene.
• Specifications
  Gene name: PSMB4; Gene ID: 5692; Accession number: BC000331; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 795; Sequence: atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgttaagttcgagggcggagtggtgattgccgcagacatgctgggatcctacggctccttggctcgtttccgcaacatctctcgcattatgcgagtcaacaacagtaccatgctgggtgcctctggcgactacgctgatttccagtatttgaagcaagttctcggccagatggtgattgatgaggagcttctgggagatggacacagctatagtcctagagctattcattcatggctgaccagggccatgtacagccggcgctcgaagatgaaccctttgtggaacaccatggtcatcggaggctatgctgatggagagagcttcctcggttatgtggacatgcttggtgtagcctatgaagccccttcgctggccactggttatggtgcatacttggctcagcctctgctgcgagaagttctggagaagcagccagtgctaagccagaccgaggcccgcgacttagtagaacgctgcatgcgagtgctgtactaccgagatgcccgttcttacaaccggtttcaaaccgccactgtcaccgaaaaaggtgttgaaatagagggaccattgtctacagagaccaactgggatattgcccacatgatcagtggctttgaatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PSMB4   cloning  
• Gene symbol
  PSMB4
• Short name
  PSMB4 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  proteasome (prosome, macropain) subunit, b classification, 4 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  proteasome (prosome, macropain) subunit, beta type, 4, HN3 and HsN3 and PROS-26 and PROS26, PSMB4 and IDBG-102368 and ENSG00000159377 and 5692, threonine-type endopeptidase activity, nuclei, Psmb4 and IDBG-170872 and ENSMUSG00000005779 and 19172, PSMB4 and IDBG-633103 and ENSBTAG00000021288 and 506203

Gene info

• Identity
  HGNC:9541
• Gene
  PSMB4
• Long gene name
  proteasome 20S subunit beta 4
• Synonyms gene name
  • proteasome (prosome, macropain) subunit, beta type, 4
  • proteasome subunit beta 4
• Synonyms
  • HN3
  • PROS26
• Synonyms name
  • proteasome subunit β7
• GenBank acession
  • D26600
• Locus
  1q21.3
• Discovery year
  1995-05-03
• Entrez gene record
  5692
• Pubmed identfication
  • 7918633
• RefSeq identity
  • NM_002796
• Classification
  • Proteasome
• VEGA ID
  OTTHUMG00000012494

Similar products