AKAP13 cloning plasmid

  • Catalog number
    CSB-CL613265HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the AKAP13 gene.
  • Specifications
    Gene name: AKAP13; Gene ID: 11214; Accession number: BC050312; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 540; Sequence: atgaaacttaatccacagcaagctcccttatatggtgattgtgttgttacagtgctgcttgctgaagaggacaaagctgaagatgatgtagtgttttacttggtatttttgggttccaccctccgtcactgtacaagtactcggaaggtcagttctgatacattggagaccattgctcctggtcatgattgttgtgaaacagtgaaggtgcagctctgtgcttccaaagagggccttcccgtgtttgtggtggctgaagaagactttcatttcgtccaggatgaagcgtatgatgcagctcaattcctagcaaccagtgctggaaatcagcaggctttgaactttacccgttttcttgaccagtcaggacccccatctggggatgtgaattcccttgataagaagttggtgctggcattcaggcacctgaagctgcccacggagtggaatgtattggggacagatcagagtttgcatggtgagaatttatatgatctacaaacacactttaagtttgtgatatttctactttttttttaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    AKAP13   cloning  
  • Gene symbol
    AKAP13
  • Short name
    AKAP13 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    A phosphorylation catalyst (PRKA) anchor protein 13 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    A kinase (PRKA) anchor protein 13, AKAP-13 and AKAP-Lbc and ARHGEF13 and BRX and c-lbc and HA-3 and Ht31 and LBC and p47 and PRKA13 and PROTO-LB and PROTO-LBC, AKAP13 and IDBG-28095 and ENSG00000170776 and 11214, protein kinase A binding, nuclei, Akap13 and IDBG-193054 and ENSMUSG00000066406 and 75547, AKAP13 and IDBG-628814 and ENSBTAG00000037383 and 504288
Gene info
  • Identity
  • Gene
  • Long gene name
    A-kinase anchoring protein 13
  • Synonyms gene
  • Synonyms gene name
    • lymphoid blast crisis oncogene
    • A kinase (PRKA) anchor protein 13
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1999-09-16
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • A-kinase anchoring proteins
    • Dbl family Rho GEFs
    • Minor histocompatibility antigens
    • Pleckstrin homology domain containing
    • MicroRNA protein coding host genes
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee