AKAP13 cloning plasmid
-
Catalog numberCSB-CL613265HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the AKAP13 gene.
-
SpecificationsGene name: AKAP13; Gene ID: 11214; Accession number: BC050312; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 540; Sequence: atgaaacttaatccacagcaagctcccttatatggtgattgtgttgttacagtgctgcttgctgaagaggacaaagctgaagatgatgtagtgttttacttggtatttttgggttccaccctccgtcactgtacaagtactcggaaggtcagttctgatacattggagaccattgctcctggtcatgattgttgtgaaacagtgaaggtgcagctctgtgcttccaaagagggccttcccgtgtttgtggtggctgaagaagactttcatttcgtccaggatgaagcgtatgatgcagctcaattcctagcaaccagtgctggaaatcagcaggctttgaactttacccgttttcttgaccagtcaggacccccatctggggatgtgaattcccttgataagaagttggtgctggcattcaggcacctgaagctgcccacggagtggaatgtattggggacagatcagagtttgcatggtgagaatttatatgatctacaaacacactttaagtttgtgatatttctactttttttttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAKAP13
-
Short nameAKAP13 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameA phosphorylation catalyst (PRKA) anchor protein 13 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetA kinase (PRKA) anchor protein 13, AKAP-13 and AKAP-Lbc and ARHGEF13 and BRX and c-lbc and HA-3 and Ht31 and LBC and p47 and PRKA13 and PROTO-LB and PROTO-LBC, AKAP13 and IDBG-28095 and ENSG00000170776 and 11214, protein kinase A binding, nuclei, Akap13 and IDBG-193054 and ENSMUSG00000066406 and 75547, AKAP13 and IDBG-628814 and ENSBTAG00000037383 and 504288
-
Gene info
-
Identity
-
Gene
-
Long gene nameA-kinase anchoring protein 13
-
Synonyms gene
-
Synonyms gene name
- lymphoid blast crisis oncogene
- A kinase (PRKA) anchor protein 13
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-09-16
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- A-kinase anchoring proteins
- Dbl family Rho GEFs
- Minor histocompatibility antigens
- Pleckstrin homology domain containing
- MicroRNA protein coding host genes
-
VEGA ID