ICAM4 cloning plasmid
-
Catalog numberCSB-CL619892HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ICAM4 gene.
-
SpecificationsGene name: ICAM4; Gene ID: 3386; Accession number: BC000046; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 819; Sequence: atggggtctctgttccctctgtcgctgctgttttttttggcggccgcctacccgggagttgggagcgcgctgggacgccggactaagcgggcgcaaagccccaagggtagccctctcgcgccctccgggacctcagtgcccttctgggtgcgcatgagcccggagttcgtggctgtgcagccggggaagtcagtgcagctcaattgcagcaacagctgtccccagccgcagaattccagcctccgcaccccgctgcggcaaggcaagacgctcagagggccgggttgggtgtcttaccagctgctcgacgtgagggcctggagctccctcgcgcactgcctcgtgacctgcgcaggaaaaacacgctgggccacctccaggatcaccgcctacagtgttcccggtgggctacttggtggtgaccctgaggcatggaagccgggtcatctattccgaaagcctggagcgcttcaccggcctggatctggccaacgtgaccttgacctacgagtttgctgctggaccccgcgacttctggcagcccgtgatctgccacgcgcgcctcaatctcgacggcctggtggtccgcaacagctcggcacccattacactgatgctcgcttggagccccgcgcccacagctttggcctccggttccatcgctgcccttgtagggatcctcctcactgtgggcgctgcgtacctatgcaagtgcctagctatgaagtcccaggcgtaaagggggatgttctatgccggctgagcgagaaaaagaggaatatgaaacaatctggggaaatggccatacatggtggctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolICAM4
-
Short nameICAM4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameintercellular adhesion molecule 4 (Landsteiner-Wiener blood group) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetintercellular adhesion molecule 4 (Landsteiner-Wiener blood group), CD242 and LW, ICAM4 and IDBG-26863 and ENSG00000105371 and 3386, integrin binding, Extracellular, Icam4 and IDBG-138732 and ENSMUSG00000001014 and 78369, ICAM4 and IDBG-643255 and ENSBTAG00000010314 and 514873
-
Gene info
-
Identity
-
Gene
-
Long gene nameintercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
-
Synonyms gene
-
Synonyms gene name
- intercellular adhesion molecule 4, Landsteiner-Wiener blood group
- Landsteiner-Wiener blood group
- intercellular adhesion molecule 4 (LW blood group)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Blood group antigens
- CD molecules
- Ig-like cell adhesion molecule family
- Immunoglobulin like domain containing
-
VEGA ID
-
Locus Specific Databases