XCL2 cloning plasmid

• Catalog number
  CSB-CL890656HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the XCL2 gene.
• Specifications
  Gene name: XCL2; Gene ID: 6846; Accession number: BC069360; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 345; Sequence: atgagacttctcatcctggccctccttggcatctgctctctcactgcatacattgtggaaggtgtagggagtgaagtctcacataggaggacctgtgtgagcctcactacccagcgactgccagttagcagaatcaagacctacaccatcacggaaggctccttgagagcagtaatttttattaccaaacgtggcctaaaagtctgtgctgatccacaagccacgtgggtgagagacgtggtcaggagcatggacaggaaatccaacaccagaaataacatgatccagaccaagccaacaggaacccagcaatcgaccaatacagctgtgaccctgactggctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  XCL2   cloning  
• Gene symbol
  XCL2
• Short name
  XCL2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  chemokine (C motif) ligand 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  chemokine (C motif) ligand 2, SCM-1b and SCM1B and SCYC2, XCL2 and IDBG-104630 and ENSG00000143185 and 6846, chemokine activity, Extracellular

Gene info

• Identity
  HGNC:10646
• Gene
  XCL2
• Long gene name
  X-C motif chemokine ligand 2
• Synonyms gene
  • SCYC2
• Synonyms gene name
  • small inducible cytokine subfamily C, member 2
  • chemokine (C motif) ligand 2
• Synonyms
  • SCM-1b
• GenBank acession
  • BC070309
• Locus
  1q24.2
• Discovery year
  1997-02-19
• Entrez gene record
  6846
• Pubmed identfication
  • 7875320
• RefSeq identity
  • NM_003175
• Classification
  • Chemokine ligands
• VEGA ID
  OTTHUMG00000034549

Similar products