TAF9 cloning plasmid
-
Catalog numberCSB-CL619078HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TAF9 gene.
-
SpecificationsGene name: TAF9; Gene ID: 6880; Accession number: BC007349; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 519; Sequence: atgttgcttccgaacatcctgctcaccggtacaccaggggttggaaaaaccacactaggcaaagaacttgcgtcaaaatcaggactgaaatacattaatgtgggtgatttagctcgagaagagcaattgtatgatggctatgatgaagagtatgactgtcccattttagatgaagacagagtagttgatgagttagataaccaaatgagagaaggtggagttattgttgattaccatggttgtgatttcttccctgaacgctggtttcatatagtttttgtgctgagaacagataccaatgtattgtacgaaagacttgaaacaaggggttataatgagaagaaactaacagacaatattcagtgtgagatttttcaagttctttatgaagaagccacagcatcctacaaggaagaaatcgtgcatcagctgcccagtaataaaccagaagagctagaaaataatgtagatcagatcttgaaatggattgagcagtggatcaaagatcataactcttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTAF9
-
Short nameTAF9 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameTAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetTAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa, TAF9 and IDBG-125230 and ENSG00000085231 and 102157402, ATPase activity, nuclei, Taf9 and IDBG-262607 and ENSMUSG00000078941 and 102216272,108143, TAF9 and IDBG-628661 and ENSBTAG00000046192 and 532936
-
Gene info
-
Identity
-
Gene
-
Long gene nameTATA-box binding protein associated factor 9
-
Synonyms gene
-
Synonyms gene name
- TATA box binding protein (TBP)-associated factor, RNA polymerase II, G, 32kD
- TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1995-07-13
-
Entrez gene record
-
Pubmed identfication
-
Classification
- General transcription factor IID complex subunits
-
VEGA ID