SNAP25 cloning plasmid
-
Catalog numberCSB-CL021873HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SNAP25 gene.
-
SpecificationsGene name: SNAP25; Gene ID: 6616; Accession number: BC010647; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 621; Sequence: atggccgaagacgcagacatgcgcaatgagctggaggagatgcagcgaagggctgaccagttggctgatgagtcgctggaaagcacccgtcgtatgctgcaactggttgaagagagtaaagatgctggtatcaggactttggttatgttggatgaacaaggagaacaactcgatcgtgtcgaagaaggcatgaaccatatcaaccaagacatgaaggaggctgagaaaaatttaaaagatttagggaaatgctgtggccttttcatatgtccttgtaacaagcttaaatcaagtgatgcttacaaaaaagcctggggcaataatcaggacggagtggtggccagccagcctgctcgtgtagtggacgaacgggagcagatggccatcagtggcggcttcatccgcagggtaacaaatgatgcccgagaaaatgaaatggatgaaaacctagagcaggtgagcggcatcatcgggaacctccgtcacatggccctggatatgggcaatgagatcgatacacagaatcgccagatcgacaggatcatggagaaggctgattccaacaaaaccagaattgatgaggccaaccaacgtgcaacaaagatgctgggaagtggttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSNAP25-AS1, SNAP25
-
Short nameSNAP25 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namesynaptosomal-associated protein, 25kDa cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetsynaptosomal-associated protein, 25kDa, bA416N4.2 and dJ1068F16.2 and RIC-4 and RIC4 and SEC9 and SNAP and SNAP-25, SNAP25 and IDBG-53941 and ENSG00000132639 and 6616, protein binding, Cell surfaces, Snap25 and IDBG-207842 and ENSMUSG00000027273 and 20614, SNAP25 and IDBG-636453 and ENSBTAG00000008323 and 540853
-
Gene info
-
Identity
-
Gene
-
Long gene nameSNAP25 antisense RNA 1
-
Synonyms gene name
- SNAP25 antisense RNA 1 (non-protein coding)
-
GenBank acession
-
Locus
-
Discovery year2012-08-09
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namesynaptosome associated protein 25
-
Synonyms gene
-
Synonyms gene name
- synaptosomal-associated protein, 25kDa
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year1995-01-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- SNAREs
-
VEGA ID