VWF cloning plasmid
-
Catalog numberCSB-CL025960HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the VWF gene.
-
SpecificationsGene name: VWF; Gene ID: 7450; Accession number: BC022258; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 822; Sequence: atgggggcacaggatgaggaggaaggaatccaagacttggatggattattagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagagactgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagagggaccctttgtgcagaaggaactcgcggcaggtcatccacggcccgatgcagccttttcggaagtgacttcgtcaacacctttgatgggagcatgtacagctttgcgggatactgcagttacctcctggcagggggctgccagaaacgctccttctcgattattggggacttccagaatggcaagagagtgagcctctccgtgtatcttggggaattttttgacatccatttgtttgtcaatggtaccgtgacacagggggaccaaagagtctccatgccctatgcctccaaagggctgtatctagaaactgaggctgggtactacaagctgtccggtgaggcctatggctttgtggccaggatcgatggcagcggcaactttcaagtcctgctgtcagacagatacttcaacaagacctgcgggctgtgtggcaactttaacatctttgctgaagatgactttatgacccaagaagggaccttgacctcggacccttatgactttgccaactcatgggctctgagcagtggagaacagtggtgtgaacgggcatctcctcccagcagctcatgcaacatctcctctggggaaatgcagaaggtgggtgtggactggcctgggtgcacctggatggtgtgtgatttctggatctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolVWF, ADAMTS13
-
Short nameVWF cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namevon Willebrand factor cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetvon Willebrand factor, F8VWF and VWD, VWF and IDBG-13506 and ENSG00000110799 and 7450, chaperone binding, Extracellular, Vwf and IDBG-189967 and ENSMUSG00000001930 and 22371, VWF and IDBG-640531 and ENSBTAG00000012265 and 280958
-
Gene info
-
Identity
-
Gene
-
Long gene namevon Willebrand factor
-
Synonyms gene
-
Locus
-
Discovery year1986-01-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Receptor ligands
-
VEGA ID
-
Locus Specific Databases
Gene info
-
Identity
-
Gene
-
Long gene nameADAM metallopeptidase with thrombospondin type 1 motif 13
-
Synonyms gene
-
Synonyms gene name
- a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-08-23
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- ADAM metallopeptidases with thrombospondin type 1 motif
-
VEGA ID
-
Locus Specific Databases