NOL3 cloning plasmid

• Catalog number
  CSB-CL015921HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NOL3 gene.
• Specifications
  Gene name: NOL3; Gene ID: 8996; Accession number: BC012798; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 627; Sequence: atgggcaacgcgcaggagcggccgtcagagactatcgaccgcgagcggaaacgcctggtcgagacgctgcaggcggactcgggactgctgttggacgcgctgctggcgcggggcgtgctcaccgggccagagtacgaggcattggatgcactgcctgatgccgagcgcagggtgcgccgcctactgctgctggtgcagggcaagggcgaggccgcctgccaggagctgctacgctgtgcccagcgtaccgcgggcgcgccggaccccgcttgggactggcagcacgtgggtccgggctaccgggaccgcagctatgaccctccatgcccaggccactggacgccggaggcacccggctcggggaccacatgccccgggttgcccagagcttcagaccctgacgaggccgggggccctgagggctccgaggcggtgcaatccgggaccccggaggagccagagccagagctggaagctgaggcctctaaagaggctgaaccggagccggagccagagccagagctggaacccgaggctgaagcagaaccagagccggaactggagccagaaccggacccagagcccgagcccgacttcgaggaaagggacgagtccgaagattcctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NOL3   cloning  
• Gene symbol
  NOL3
• Short name
  NOL3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  nucleolar protein 3 (apoptosis repressor with CARD domain) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  nucleolar protein 3 (apoptosis repressor with CARD domain), ARC and FCM and MYP and NOP and NOP30, NOL3 and IDBG-36117 and ENSG00000140939 and 8996, identical protein binding, nuclei, Nol3 and IDBG-187078 and ENSMUSG00000014776 and 78688, NOL3 and IDBG-633333 and ENSBTAG00000003519 and 515777

Gene info

• Identity
  HGNC:7869
• Gene
  NOL3
• Long gene name
  nucleolar protein 3
• Synonyms gene name
  • nucleolar protein 3 (apoptosis repressor with CARD domain)
• Synonyms
  • ARC
  • NOP30
  • MYP
  • CARD2
• GenBank acession
  • AF043244
• Locus
  16q22.1
• Discovery year
  1999-01-13
• Entrez gene record
  8996
• Pubmed identfication
  • 9560245
• Classification
  • Caspase recruitment domain containing
• VEGA ID
  OTTHUMG00000173316

Similar products