CDKN1A cloning plasmid
-
Catalog numberCSB-CL005086HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CDKN1A gene.
-
SpecificationsGene name: CDKN1A; Gene ID: 1026; Accession number: BC000275; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 495; Sequence: atgtcagaaccggctggggatgtccgtcagaacccatgcggcagcaaggcctgccgccgcctcttcggcccagtggacagcgagcagctgagccgcgactgtgatgcgctaatggcgggctgcatccaggaggcccgtgagcgatggaacttcgactttgtcaccgagacaccactggagggtgacttcgcctgggagcgtgtgcggggccttggcctgcccaagctctaccttcccacggggccccggcgaggccgggatgagttgggaggaggcaggcggcctggcacctcacctgctctgctgcaggggacagcagaggaagaccatgtggacctgtcactgtcttgtacccttgtgcctcgctcaggggagcaggctgaagggtccccaggtggacctggagactctcagggtcgaaaacggcggcagaccagcatgacagatttctaccactccaaacgccggctgatcttctccaagaggaagccctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCDKN1A-AS1, CDKN1A
-
Short nameCDKN1A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namecyclin-dependent phosphorylation catalyst inhibitor 1A (p21, Cip1) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetcyclin-dependent kinase inhibitor 1A (p21, Cip1), CAP20 and CDKN1 and CIP1 and MDA-6 and P21 and p21CIP1 and SDI1 and WAF1, CDKN1A and IDBG-85033 and ENSG00000124762 and 1026, metal ion binding, nuclei, Cdkn1a and IDBG-159848 and ENSMUSG00000023067 and 12575, CDKN1A and IDBG-630156 and ENSBTAG00000008353 and 513497
-
Gene info
-
Identity
-
Gene
-
Long gene nameCDKN1A antisense RNA 1
-
Synonyms gene name
- CDKN1A antisense RNA 1 (non-protein coding)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2011-07-11
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene namecyclin dependent kinase inhibitor 1A
-
Synonyms gene
-
Synonyms gene name
- cyclin-dependent kinase inhibitor 1A (p21, Cip1)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1994-05-24
-
Entrez gene record
-
RefSeq identity
-
VEGA ID