CDKN1A cloning plasmid

• Catalog number
  CSB-CL005086HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CDKN1A gene.
• Specifications
  Gene name: CDKN1A; Gene ID: 1026; Accession number: BC000275; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 495; Sequence: atgtcagaaccggctggggatgtccgtcagaacccatgcggcagcaaggcctgccgccgcctcttcggcccagtggacagcgagcagctgagccgcgactgtgatgcgctaatggcgggctgcatccaggaggcccgtgagcgatggaacttcgactttgtcaccgagacaccactggagggtgacttcgcctgggagcgtgtgcggggccttggcctgcccaagctctaccttcccacggggccccggcgaggccgggatgagttgggaggaggcaggcggcctggcacctcacctgctctgctgcaggggacagcagaggaagaccatgtggacctgtcactgtcttgtacccttgtgcctcgctcaggggagcaggctgaagggtccccaggtggacctggagactctcagggtcgaaaacggcggcagaccagcatgacagatttctaccactccaaacgccggctgatcttctccaagaggaagccctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CDKN1A   cloning  
• Gene symbol
  CDKN1A-AS1, CDKN1A
• Short name
  CDKN1A cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  cyclin-dependent phosphorylation catalyst inhibitor 1A (p21, Cip1) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  cyclin-dependent kinase inhibitor 1A (p21, Cip1), CAP20 and CDKN1 and CIP1 and MDA-6 and P21 and p21CIP1 and SDI1 and WAF1, CDKN1A and IDBG-85033 and ENSG00000124762 and 1026, metal ion binding, nuclei, Cdkn1a and IDBG-159848 and ENSMUSG00000023067 and 12575, CDKN1A and IDBG-630156 and ENSBTAG00000008353 and 513497

Gene info

• Identity
  HGNC:42399
• Gene
  CDKN1A-AS1
• Long gene name
  CDKN1A antisense RNA 1
• Synonyms gene name
  • CDKN1A antisense RNA 1 (non-protein coding)
• Synonyms
  • p21NAT
• GenBank acession
  • BX332409
• Locus
  6p21.1
• Discovery year
  2011-07-11
• Entrez gene record
  100861512
• Pubmed identfication
  • 19008947
• Classification
  • Antisense RNAs

Gene info

• Identity
  HGNC:1784
• Gene
  CDKN1A
• Long gene name
  cyclin dependent kinase inhibitor 1A
• Synonyms gene
  • CDKN1
• Synonyms gene name
  • cyclin-dependent kinase inhibitor 1A (p21, Cip1)
• Synonyms
  • P21
  • CIP1
  • WAF1
  • SDI1
  • CAP20
  • p21CIP1
  • p21Cip1/Waf1
  • p21
• GenBank acession
  • U03106
• Locus
  6p21.2
• Discovery year
  1994-05-24
• Entrez gene record
  1026
• RefSeq identity
  • NM_078467
• VEGA ID
  OTTHUMG00000014603

Similar products