HSPB11 cloning plasmid
#
-
Catalog numberCSB-CL897286HU-10ug
-
Price:
-
Size10ug
-
-
DescriptionA cloning plasmid for the HSPB11 gene.
-
SpecificationsGene name: HSPB11; Gene ID: 51668; Accession number: BC005245; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 435; Sequence: atgagaaaaattgatctctgtctgagctctgaagggtccgaagtgattttagctacatcaagtgatgaaaaacacccacctgaaaatatcattgatgggaatccagaaacgttttggaccaccacaggaatgtttccccaggaattcattatttgtttccacaaacatgtaaggattgaaaggcttgtaatccaaagttactttgtacagaccttgaagattgaaaaaagcacgtctaaagagccagttgattttgagcaatggattgaaaaagatttggtacacacagaggggcagcttcaaaatgaagaaattgtggcacatgatggctccgctacttacttgagattcattattgtatcagcctttgatcattttgcatctgtgcatagcgtttctgcagaaggaacagtagtctcaaatctttcctcataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolHSPB11
-
Short nameHSPB11 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameheat shock protein family B (small), member 11 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetheat shock protein family B (small), member 11, HSPB11 and IDBG-98847 and ENSG00000081870 and 51668, metal ion binding, multiple, Hspb11 and IDBG-171460 and ENSMUSG00000063172 and 72938, C3H1ORF41 and IDBG-639177 and ENSBTAG00000007112 and 616194
-
Gene info
-
Identity
-
Gene
-
Long gene nameheat shock protein family B (small) member 11
-
Synonyms gene
-
Synonyms gene name
- chromosome 1 open reading frame 41
- heat shock protein family B (small), member 11
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-06-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- IFT-B1 complex
- Small heat shock proteins
-
VEGA ID