FKBP2 cloning plasmid
-
Catalog numberCSB-CL008698HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FKBP2 gene.
-
SpecificationsGene name: FKBP2; Gene ID: 2286; Accession number: BC003384; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 429; Sequence: atgaggctgagctggttccgggtcctgacagtactgtccatctgcctgagcgccgtggccacggccacgggggccgagggcaaaaggaagctgcagatcggggtcaagaagcgggtggaccactgtcccatcaaatcgcgcaaaggggatgtcctgcacatgcactacacggggaagctggaagatgggacagagtttgacagcagcctgccccagaaccagccctttgtcttctcccttggcacaggccaggtcatcaagggctgggaccaggggctgctggggatgtgtgagggggaaaagcgcaagctggtgatcccatccgagctagggtatggagagcggggagctcccccaaagattccaggcggtgcaaccctggtgttcgaggtggagctgctcaaaatagagcgacgaactgagctgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolFKBP2
-
Short nameFKBP2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameFK506 binding protein 2, 13kDa cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetFK506 binding protein 2, 13kDa, FKBP-13 and PPIase, FKBP2 and IDBG-53311 and ENSG00000173486 and 2286, FK506 binding, Cytoplasm, Fkbp2 and IDBG-137677 and ENSMUSG00000056629 and 14227
-
Gene info
-
Identity
-
Gene
-
Long gene nameFKBP prolyl isomerase 2
-
Synonyms gene name
- FK506-binding protein 2 (13kD)
- FK506 binding protein 2, 13kDa
- FK506 binding protein 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1992-09-14
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- FKBP prolyl isomerases
-
VEGA ID