CD81 cloning plasmid
-
Catalog numberCSB-CL004960HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CD81 gene.
-
SpecificationsGene name: CD81; Gene ID: 975; Accession number: BC002978; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 711; Sequence: atgggagtggagggctgcaccaagtgcatcaagtacctgctcttcgtcttcaatttcgtcttctggctggctggaggcgtgatcctgggtgtggccctgtggctccgccatgacccgcagaccaccaacctcctgtatctggagctgggagacaagcccgcgcccaacaccttctatgtaggcatctacatcctcatcgctgtgggcgctgtcatgatgttcgttggcttcctgggctgctacggggccatccaggaatcccagtgcctgctggggacgttcttcacctgcctggtcatcctgtttgcctgtgaggtggccgccggcatctggggctttgtcaacaaggaccagatcgccaaggatgtgaagcagttctatgaccaggccctacagcaggccgtggtggatgatgacgccaacaacgccaaggctgtggtgaagaccttccacgagacgcttgactgctgtggctccagcacactgactgctttgaccacctcagtgctcaagaacaatttgtgtccctcgggcagcaacatcatcagcaacctcttcaaggaggactgccaccagaagatcgatgacctcttctccgggaagctgtacctcatcggcattgctgccatcgtggtcgctgtgatcatgatcttcgagatgatcctgagcatggtgctgtgctgtggcatccggaacagctccgtgtactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCD81-AS1, CD81
-
Short nameCD81 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameCD81 molecule cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetCD81 molecule, CVID6 and S5.7 and TAPA1 and TSPAN28, CD81 and IDBG-22455 and ENSG00000110651 and 975, MHC class II protein complex binding, Cell surfaces, Cd81 and IDBG-212677 and ENSMUSG00000037706 and 12520, CD81 and IDBG-645214 and ENSBTAG00000047495 and 511435
-
Gene info
-
Identity
-
Gene
-
Long gene nameCD81 antisense RNA 1
-
GenBank acession
-
Locus
-
Discovery year2013-10-18
-
Entrez gene record
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameCD81 molecule
-
Synonyms gene
-
Synonyms gene name
- CD81 antigen (target of antiproliferative antibody 1)
-
Synonyms
-
Locus
-
Discovery year1992-10-21
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Tetraspanins
- CD molecules
-
VEGA ID
-
Locus Specific Databases