PSMD4 cloning plasmid
-
Catalog numberCSB-CL018908HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSMD4 gene.
-
SpecificationsGene name: PSMD4; Gene ID: 5710; Accession number: BC002365; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1134; Sequence: atggtgttggaaagcactatggtgtgtgtggacaacagtgagtatatgcggaatggagacttcttacccaccaggctgcaggcccagcaggatgctgtcaacatagtttgtcattcaaagacccgcagcaaccctgagaacaacgtgggccttatcacactggctaatgactgtgaagtgctgaccacactcaccccagacactggccgtatcctgtccaagctacatactgtccaacccaagggcaagatcaccttctgcacgggcatccgcgtggcccatctggctctgaagcaccgacaaggcaagaatcacaagatgcgcatcattgcctttgtgggaagcccagtggaggacaatgagaaggatctggtgaaactggctaaacgcctcaagaaggagaaagtaaatgttgacattatcaattttggggaagaggaggtgaacacagaaaagctgacagcctttgtaaacacgttgaatggcaaagatggaaccggttctcatctggtgacagtgcctcctgggcccagtttggctgatgctctcatcagttctccgattttggctggtgaaggtggtgccatgctgggtcttggtgccagtgactttgaatttggagtagatcccagtgctgatcctgagctggccttggcccttcgtgtatctatggaagagcagcggcagcggcaggaggaggaggcccggcgggcagctgcagcttctgctgctgaggccgggattgctacgactgggactgaagactcagacgatgccctgctgaagatgaccatcagccagcaagagtttggccgcactgggcttcctgacctaagcagtatgactgaggaagagcagattgcttatgccatgcagatgtccctgcagggagcagagtttggccaggcggaatcagcagacattgatgccagctcagctatggacacatctgagccagccaaggaggaggatgattacgacgtgatgcaggaccccgagttccttcagagtgtcctagagaacctcccaggtgtggatcccaacaatgaagccattcgaaatgctatgggctccctggcctcccaggccaccaaggacggcaagaaggacaagaaggaggaagacaagaagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPIPSL, PSMD4
-
Short namePSMD4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) 26S subunit, non-ATPase, 4, AF and AF-1 and ASF and MCB1 and pUB-R5 and Rpn10 and S5A, PSMD4 and IDBG-102328 and ENSG00000159352 and 5710, poly(A) RNA binding, nuclei, Psmd4 and IDBG-171250 and ENSMUSG00000005625 and 19185, PSMD4 and IDBG-633157 and ENSBTAG00000006101 and 282016
-
Gene info
-
Identity
-
Gene
-
Long gene namePIP5K1A and PSMD4 like (pseudogene)
-
Synonyms gene
-
Synonyms gene name
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2
- phosphatidylinositol-4-phosphate 5-kinase, type I-like 1
- PIP5K1A and PSMD4-like
- PIP5K1A and PSMD4-like, pseudogene
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2003-12-04
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome 26S subunit ubiquitin receptor, non-ATPase 4
-
Synonyms gene name
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
- proteasome 26S subunit, non-ATPase 4
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1995-11-28
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Proteasome
-
VEGA ID