PSMD4 cloning plasmid

  • Catalog number
    CSB-CL018908HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the PSMD4 gene.
  • Specifications
    Gene name: PSMD4; Gene ID: 5710; Accession number: BC002365; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1134; Sequence: atggtgttggaaagcactatggtgtgtgtggacaacagtgagtatatgcggaatggagacttcttacccaccaggctgcaggcccagcaggatgctgtcaacatagtttgtcattcaaagacccgcagcaaccctgagaacaacgtgggccttatcacactggctaatgactgtgaagtgctgaccacactcaccccagacactggccgtatcctgtccaagctacatactgtccaacccaagggcaagatcaccttctgcacgggcatccgcgtggcccatctggctctgaagcaccgacaaggcaagaatcacaagatgcgcatcattgcctttgtgggaagcccagtggaggacaatgagaaggatctggtgaaactggctaaacgcctcaagaaggagaaagtaaatgttgacattatcaattttggggaagaggaggtgaacacagaaaagctgacagcctttgtaaacacgttgaatggcaaagatggaaccggttctcatctggtgacagtgcctcctgggcccagtttggctgatgctctcatcagttctccgattttggctggtgaaggtggtgccatgctgggtcttggtgccagtgactttgaatttggagtagatcccagtgctgatcctgagctggccttggcccttcgtgtatctatggaagagcagcggcagcggcaggaggaggaggcccggcgggcagctgcagcttctgctgctgaggccgggattgctacgactgggactgaagactcagacgatgccctgctgaagatgaccatcagccagcaagagtttggccgcactgggcttcctgacctaagcagtatgactgaggaagagcagattgcttatgccatgcagatgtccctgcagggagcagagtttggccaggcggaatcagcagacattgatgccagctcagctatggacacatctgagccagccaaggaggaggatgattacgacgtgatgcaggaccccgagttccttcagagtgtcctagagaacctcccaggtgtggatcccaacaatgaagccattcgaaatgctatgggctccctggcctcccaggccaccaaggacggcaagaaggacaagaaggaggaagacaagaagtga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    PSMD4   cloning  
  • Gene symbol
    PIPSL, PSMD4
  • Short name
    PSMD4 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, AF and AF-1 and ASF and MCB1 and pUB-R5 and Rpn10 and S5A, PSMD4 and IDBG-102328 and ENSG00000159352 and 5710, poly(A) RNA binding, nuclei, Psmd4 and IDBG-171250 and ENSMUSG00000005625 and 19185, PSMD4 and IDBG-633157 and ENSBTAG00000006101 and 282016
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    proteasome 26S subunit ubiquitin receptor, non-ATPase 4
  • Synonyms gene name
    • proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
    • proteasome 26S subunit, non-ATPase 4
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1995-11-28
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • Proteasome
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee