LGALS12 cloning plasmid

• Catalog number
  CSB-CL846606HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the LGALS12 gene.
• Specifications
  Gene name: LGALS12; Gene ID: 85329; Accession number: BC028222; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1011; Sequence: atgagtcagcccagtgggggcagggctcctggaacgaggatctacagttggagttgccccactgtcatgtcacctggagaaaaactggacccaattcctgacagcttcattctgcaaccaccagtcttccacccggtggttccttatgtcacgacgatttttggaggcctgcatgcaggcaagatggtcatgctgcaaggagtggtccctctagatgcacacaggtttcaggtggacttccagtgtggctgcagcctgtgtccccggccagatatcgccttccacttcaaccctcgcttccataccaccaagccccatgtcatctgcaacaccctgcatggtggacgctggcaaagggaggcccggtggccccacctggccctgcgaagaggctccagcttcctcatcctctttctcttcgggaatgaggaagtgaaggtgagtgtgaatggacagcactttctccacttccgctaccggctcccactgtctcatgtggacacgctgggtatatttggtgacatcctggtagaggctgttggattcctgaacatcaatccatttgtggagggcagcagagagtacccagctggacatcctttcctgctgatgagccccaggctggaggtgccctgctcacatgctcttccccagggtctctcgcctgggcaggtcatcatagtacggggactggtcttgcaagagccgaagcattttactgtgagcctgagggaccaggctgcccatgctcctgtgacactcagggcctccttcgcagacagaactctggcctggatctcccgctgggggcagaagaaactgatctcagcccccttcctcttttacccccagagattctttgaggtgctgctcctgttccaggagggagggctgaagctggcgctcaatgggcaggggctgggggccaccagcatgaaccagcaggccctggagcagctgcgggagctccggatcagtggaagtgtccagctctactgtgtccactcctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  LGALS12   cloning  
• Gene symbol
  LGALS12
• Short name
  LGALS12 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  lectin, galactoside-binding, soluble, 12 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  lectin, galactoside-binding, soluble, 12, LGALS12 and IDBG-52486 and ENSG00000133317 and 85329, lactose binding, nuclei, Lgals12 and IDBG-139287 and ENSMUSG00000024972 and 56072, LGALS12 and IDBG-643788 and ENSBTAG00000007108 and 518931

Gene info

• Identity
  HGNC:15788
• Gene
  LGALS12
• Long gene name
  galectin 12
• Synonyms gene name
  • lectin, galactoside-binding, soluble, 12
• Synonyms
  • GRIP1
• GenBank acession
  • AF222695
• Locus
  11q12.3
• Discovery year
  2001-11-14
• Entrez gene record
  85329
• Pubmed identfication
  • 11283015
  • 11435439
• RefSeq identity
  • NM_033101
• Classification
  • Galectins
• VEGA ID
  OTTHUMG00000167807

Similar products