RBP4 cloning plasmid

• Catalog number
  CSB-CL019483HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the RBP4 gene.
• Specifications
  Gene name: RBP4; Gene ID: 5950; Accession number: BC020633; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 606; Sequence: atgaagtgggtgtgggcgctctttctgttggcggcgctgggcagcggccgcgcggagcgcgactgccgagtgagcagcttccgagtcaaggagaacttcgacaaggctcgcttctctgggacctggtacgccatggccaagaaggaccccgagggcctctttctgcaggacaacatcgtcgcggagttctccgtggacgagaccggccagatgagcgccacagccaagggccgagtccgtcttttgaataactgggacgtgtgcgcagacatggtgggcaccttcacagacaccgaggaccctgccaagttcaagatgaagtactggggcgtagcctcctttctccagaaaggaaatgatgaccactggatcgtcgacacagactacgacacgtatgccgtgcagtactcctgccgcctcctgaacctcgatggcacctgtgctgacagctactccttcgtgttttcccgggaccccaacggcctgcccccagaagcgcagaagattgtaaggcagcggcaggaggagctgtgcctggccaggcagtacaggctgatcgtccacaacggttactgcgatggcagatcagaaagaaaccttttgtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  RBP4   cloning  
• Gene symbol
  RBP4
• Short name
  RBP4 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  retinol binding protein 4, plasma cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  retinol binding protein 4, plasma, RDCCAS, RBP4 and IDBG-82806 and ENSG00000138207 and 5950, protein heterodimerization activity, Extracellular, Rbp4 and IDBG-162693 and ENSMUSG00000024990 and 19662, RBP4 and IDBG-637726 and ENSBTAG00000000442 and 281444

Gene info

• Identity
  HGNC:9922
• Gene
  RBP4
• Long gene name
  retinol binding protein 4
• Synonyms gene name
  • retinol-binding protein 4, plasma
• GenBank acession
  • BC020633
• Locus
  10q23.33
• Discovery year
  2001-06-22
• Entrez gene record
  5950
• RefSeq identity
  • NM_006744
• Classification
  • Lipocalins
• VEGA ID
  OTTHUMG00000018773

Similar products