PLA2G2A cloning plasmid
-
Catalog numberCSB-CL018091HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PLA2G2A gene.
-
SpecificationsGene name: PLA2G2A; Gene ID: 5320; Accession number: BC005919; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 435; Sequence: atgaagaccctcctactgttggcagtgatcatgatctttggcctactgcaggcccatgggaatttggtgaatttccacagaatgatcaagttgacgacaggaaaggaagccgcactcagttatggcttctacggctgccactgtggcgtgggtggcagaggatcccccaaggatgcaacggatcgctgctgtgtcactcatgactgttgctacaaacgtctggagaaacgtggatgtggcaccaaatttctgagctacaagtttagcaactcggggagcagaatcacctgtgcaaaacaggactcctgcagaagtcaactgtgtgagtgtgataaggctgctgccacctgttttgctagaaacaagacgacctacaataaaaagtaccagtactattccaataaacactgcagagggagcacccctcgttgctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPLA2G2A
-
Short namePLA2G2A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namephospholipase A2, family IIA (platelets, synovial fluid) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetphospholipase A2, group IIA (platelets, synovial fluid), MOM1 and PLA2 and PLA2B and PLA2L and PLA2S and PLAS1 and sPLA2, PLA2G2A and IDBG-92794 and ENSG00000188257 and 5320, calcium-dependent phospholipase A2 activity, Extracellular, Pla2g2a and IDBG-200035 and ENSMUSG00000058908 and 18780
-
Gene info
-
Identity
-
Gene
-
Long gene namephospholipase A2 group IIA
-
Synonyms gene
-
Synonyms gene name
- phospholipase A2, group IIA (platelets, synovial fluid)
-
GenBank acession
-
Locus
-
Discovery year1989-04-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Phospholipases
-
VEGA ID