TAX1BP3 cloning plasmid
-
Catalog numberCSB-CL023180HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TAX1BP3 gene.
-
SpecificationsGene name: TAX1BP3; Gene ID: 30851; Accession number: BC023980; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 375; Sequence: atgtcctacatcccgggccagccggtcaccgccgtggtgcaaagagttgaaattcacaagctgcgtcaaggtgagaacttaatcctgggtttcagcattggaggtggaatcgaccaggacccttcccagaatcccttctctgaagacaagacggacaagggtatttatgtcacacgggtgtctgaaggaggccctgctgaaatcgctgggctgcagattggagacaagatcatgcaggtgaacggctgggacatgaccatggtcacacacgaccaggcccgcaagcggctcaccaagcgctcggaggaggtggtgcgtctgctggtgacgcggcagtcgctgcagaaggccgtgcagcagtccatgctgtcctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolP2RX5-TAX1BP3, TAX1BP3
-
Short nameTAX1BP3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameTax1 (H. sapiens T-cellular leukemia virus classification I) binding protein 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetTax1 (human T-cell leukemia virus type I) binding protein 3, TAX1BP3 and IDBG-236056 and ENSG00000213977 and 30851, protein C-terminus binding, nuclei, Tax1bp3 and IDBG-197954 and ENSMUSG00000040158 and 102642885,76281, TAX1BP3 and IDBG-633270 and ENSBTAG00000000833 and 514852
-
Gene info
-
Identity
-
Gene
-
Long gene nameP2RX5-TAX1BP3 readthrough (NMD candidate)
-
Locus
-
Discovery year2013-09-25
-
Entrez gene record
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameTax1 binding protein 3
-
Synonyms gene name
- Tax1 (human T-cell leukemia virus type I) binding protein 3
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-06-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- PDZ domain containing
-
VEGA ID