PDCD10 cloning plasmid
-
Catalog numberCSB-CL861141HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PDCD10 gene.
-
SpecificationsGene name: PDCD10; Gene ID: 11235; Accession number: BC002506; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 639; Sequence: atgaggatgacaatggaagagatgaagaatgaagctgagaccacatccatggtttctatgcccctctatgcagtcatgtatcctgtgtttaatgagctagaacgagtaaatctgtctgcagcccagacactgagagccgctttcatcaaggctgaaaaagaaaatccaggtctcacacaagacatcattatgaaaattttagagaaaaaaagcgtggaagttaacttcacggagtcccttcttcgtatggcagctgatgatgtagaagagtatatgattgaacgaccagagccagaattccaagacctaaacgaaaaggcacgagcacttaaacaaattctcagtaagatcccagatgagatcaatgacagagtgaggtttctgcagacaatcaaggatatagctagtgcaataaaagaacttcttgatacagtgaataatgtcttcaagaaatatcaataccagaaccgcagggcacttgaacaccaaaagaaagaatttgtaaagtactccaaaagtttcagtgatactctgaaaacgtattttaaagatggcaaggcaataaatgtgttcgtaagtgccaaccgactaattcatcaaaccaacttaatacttcagaccttcaaaactgtggcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPDCD10
-
Short namePDCD10 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprogrammed cellular death 10 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprogrammed cell death 10, CCM3 and TFAR15, PDCD10 and IDBG-64018 and ENSG00000114209 and 11235, protein N-terminus binding, Plasma membranes, Pdcd10 and IDBG-152450 and ENSMUSG00000027835 and 56426, PDCD10 and IDBG-636835 and ENSBTAG00000031709 and 506411,785119
-
Gene info
-
Identity
-
Gene
-
Long gene nameprogrammed cell death 10
-
Synonyms gene
-
Synonyms gene name
- cerebral cavernous malformations 3
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-12-10
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- CCM adhesion complex
- STRIPAK complex
-
VEGA ID
-
Locus Specific Databases