PSMG1 cloning plasmid

• Catalog number
  CSB-CL018921HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PSMG1 gene.
• Specifications
  Gene name: PSMG1; Gene ID: 8624; Accession number: BC003619; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 867; Sequence: atggcggccacgttcttcggagaggtggtgaaggcgccgtgccgagctgggactgaggacgaagaggaggaggaggaggggcggagggagacgcccgaggacagggaggtgcgtctgcagctggcgcggaagagggaagtgcggctccttcgaagacaaacaaaaacatctttggaagtttctttgctagaaaaatatccgtgctccaagtttataattgctataggaaataatgcagtagcatttctgtcatcatttgttatgaattcaggagtctgggaggaagttggttgtgctaaactctggaatgaatggtgtagaacaacagacactacacatctgtcctccacagaggctttttgtgtgttttatcatctaaaatccaatccctcggtttttctctgtcagtgcagttgctatgttgcagaagatcaacagtatcagtggctggaaaaggtttttggctcttgtccaaggaagaacatgcagataactattctcacatgtcgacatgttaccgattataaaacctcagaatccaccggcagccttccttctcctttcctgagagccctaaaaacacagaatttcaaagactcggcgtgttgtccattgctagaacaaccgaatatagtacacgaccttcctgcagcagttctaagctactgtcaagtatggaaaatcccggcaattctgtacttgtgttatactgatgtgatgaaattagacctaatcacagtggaagcttttaagcctatactttctaccagaagcttgaagggtttggttaagaatattccccaaagcactgagatactaaagaaattgatgacaacaaatgagattcagagtaacatttatacatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PSMG1   cloning  
• Gene symbol
  PSMG1
• Short name
  PSMG1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  proteasome (prosome, macropain) assembly chaperone 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  proteasome (prosome, macropain) assembly chaperone 1, C21LRP and DSCR2 and LRPC21 and PAC-1 and PAC1, PSMG1 and IDBG-3364 and ENSG00000183527 and 8624, proteasome binding, nuclei, Psmg1 and IDBG-179306 and ENSMUSG00000022913 and 56088, PSMG1 and IDBG-639136 and ENSBTAG00000013600 and 614817

Gene info

• Identity
  HGNC:3043
• Gene
  PSMG1
• Long gene name
  proteasome assembly chaperone 1
• Synonyms gene
  • DSCR2
• Synonyms gene name
  • Down syndrome critical region gene 2
  • proteasome (prosome, macropain) assembly chaperone 1
• Synonyms
  • c21-LRP
  • LRPC21
  • PAC1
• GenBank acession
  • AJ006291
• Locus
  21q22.2
• Discovery year
  1999-09-17
• Entrez gene record
  8624
• Pubmed identfication
  • 10872820
  • 17189198
• RefSeq identity
  • NM_003720
• VEGA ID
  OTTHUMG00000066034

Similar products