ATP4B cloning plasmid

• Catalog number
  CSB-CL002343HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ATP4B gene.
• Specifications
  Gene name: ATP4B; Gene ID: 496; Accession number: BC029059; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 876; Sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcctctatgtgctgatgcagacagtggacccgtacacaccggactaccaagaccagctacggtcaccaggggtaaccttaaggccggatgtttacggggagaaaggcctggaaattgtctacaacgtctctgataacagaacctgggcagacctcacacagactctccacgccttcctagcaggctactctccagcagcccaggaggacagcatcaactgcacctccgagcagtacttcttccaggagagtttccgcgctcccaaccacaccaagttctcctgcaagttcacggcagatatgctgcagaactgctcaggcctggcggatcccaacttcggctttgaagaaggaaagccatgttttattattaaaatgaacaggatcgtcaagttcctccccagcaacggctcggcccccagagtggactgcgccttcctggaccagccccgcgagctcggccagccgctgcaggtcaagtactaccctcccaacggcaccttcagtctgcactacttcccttattacgggaagaaagcccagccccactacagcaaccccctggtggcagcgaagctcctcaacatccccaggaacgctgaggtcgccatcgtgtgcaaggtcatggcagagcacgtgaccttcaacaatccccacgacccgtatgaagggaaagtggagttcaaactcaagattgagaagtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ATP4B   cloning  
• Gene symbol
  ATP4B
• Short name
  ATP4B cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  ATPase, H+/K+ exchanging, b polypeptide cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  ATPase, H+/K+ exchanging, beta polypeptide, ATP6B, ATP4B and IDBG-53569 and ENSG00000186009 and 496, potassium-exchanging ATPase activity, Plasma membranes, Atp4b and IDBG-135260 and ENSMUSG00000031449 and 11945, BT.29440 and IDBG-634494 and ENSBTAG00000019961 and 614308

Gene info

• Identity
  HGNC:820
• Gene
  ATP4B
• Long gene name
  ATPase H+/K+ transporting subunit beta
• Synonyms gene name
  • ATPase, H+/K+ exchanging, beta polypeptide
  • ATPase H+/K+ transporting beta subunit
• Synonyms
  • ATP6B
• Locus
  13q34
• Discovery year
  1992-11-26
• Entrez gene record
  496
• Pubmed identfication
  • 1330887
  • 15057823
• RefSeq identity
  • NM_000705
• Classification
  • ATPase H+/K+ transporting
• VEGA ID
  OTTHUMG00000140234

Similar products