PSME1 cloning plasmid
-
Catalog numberCSB-CL018915HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSME1 gene.
-
SpecificationsGene name: PSME1; Gene ID: 5720; Accession number: BC000352; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 750; Sequence: atggccatgctcagggtccagcccgaggcccaagccaaggtggatgtgtttcgtgaagacctctgtaccaagacagagaacctgctcgggagctatttccccaagaagatttctgagctggatgcatttttaaaggagccagctctcaatgaagccaacttgagcaatctgaaggccccattggacatcccagtgcctgatccagtcaaggagaaagagaaagaggagcggaagaaacagcaggagaaggaagacaaggatgaaaagaagaagggggaggatgaagacaaaggtcctccctgtggcccagtgaactgcaatgaaaagatcgtggtccttctgcagcgcttgaagcctgagatcaaggatgtcattgagcagctcaacctggtcaccacctggttgcagctgcagatacctcggattgaggatggtaacaattttggagtggctgtccaggagaaggtgtttgagctgatgaccagcctccacaccaagctagaaggcttccacactcaaatctctaagtatttctctgagcgtggtgatgcagtgactaaagcagccaagcagccccatgtgggtgattatcggcagctggtgcacgagctggatgaggcagagtaccgggacatccggctgatggtcatggagatccgcaatgcttatgctgtgttatatgacatcatcctgaagaacttcgagaagctcaagaagcccaggggagaaacaaagggaatgatctattga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPSME1
-
Short namePSME1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) activator subunit 1 (PA28 alpha) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) activator subunit 1 (PA28 alpha), IFI5111 and PA28A and PA28alpha and REGalpha, PSME1 and IDBG-3523 and ENSG00000092010 and 5720, endopeptidase activator activity, nuclei, Psme1 and IDBG-164103 and ENSMUSG00000022216 and 19186, PSME1 and IDBG-645750 and ENSBTAG00000021395 and 510041
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome activator subunit 1
-
Synonyms gene name
- proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
-
Synonyms
-
Locus
-
Discovery year1997-02-11
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Proteasome
-
VEGA ID