C1D cloning plasmid
-
Catalog numberCSB-CL623834HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the C1D gene.
-
SpecificationsGene name: C1D; Gene ID: 10438; Accession number: BC005235; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 426; Sequence: atggcaggtgaagaaattaatgaagactatccagtagaaattcacgagtatttgtcagcgtttgagaattccattggtgctgtggatgagatgctgaagaccatgatgtctgtttctagaaatgagttgttgcagaagttggatccacttgaacaagcaaaagtggatttggtttctgcatacacattaaattcaatgttttgggtttatttggcaacccaaggagttaatcctaaggaacatccagtaaaacaggaattggaaagaatcagagtatatatgaacagagtcaaggaaataacagacaagaaaaaggctggcaagctggacagaggtgcagcttcaagatttgtaaaaaatgccctctgggaaccaaaatcgaaaaatgcatcaaaagttgccaataaaggaaaaagcaaaagttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolWDR93, C1D
-
Short nameC1D cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameC1D nuclear receptor corepressor cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetC1D nuclear receptor corepressor, hC1D and LRP1 and SUN-CoR and SUNCOR, C1D and IDBG-54438 and ENSG00000197223 and 10438, ligand-dependent nuclear receptor binding, nuclei, C1d and IDBG-152088 and ENSMUSG00000000581 and 57316, C1D and IDBG-635663 and ENSBTAG00000004567 and 506667
-
Gene info
-
Identity
-
Gene
-
Long gene nameWD repeat domain 93
-
Synonyms
-
Locus
-
Discovery year2007-11-19
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- WD repeat domain containing
- Cilia and flagella associated
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameC1D nuclear receptor corepressor
-
Synonyms gene name
- C1D nuclear receptor co-repressor
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year2009-02-06
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID