NPTN cloning plasmid
-
Catalog numberCSB-CL016028HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NPTN gene.
-
SpecificationsGene name: NPTN; Gene ID: 27020; Accession number: BC117462; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 849; Sequence: atgtcgggttcgtcgctgcccagcgccctggccctctcgctgttgctggtctctggctccctcctcccagggccaggcgccgctcagaacgagccaaggattgtcaccagtgaagaggtcattattcgagacagccctgttctccctgtcaccctgcagtgtaacctcacctccagctctcacacccttacatacagctactggacaaagaatggggtggaactgagtgccactcgtaagaatgccagcaacatggagtacaggatcaataagccgagagctgaggattcaggcgaataccactgcgtatatcactttgtcagcgctcctaaagcaaacgccaccattgaagtgaaagccgctcctgacatcactggccataaacggagtgagaacaagaatgaagggcaggatgccactatgtattgcaagtcagttggctacccccacccagactggatatggcgcaagaaggagaacgggatgcccatggacattgtcaatacctctggccgcttcttcatcatcaacaaggaaaattacactgagttgaacattgtgaacctgcagatcacggaagaccctggcgagtatgaatgtaatgccaccaacgccattggctccgcctctgttgtcactgtcctcagggtgcggagccacctggccccactctggcctttcttgggaattctggctgaaattatcatccttgtggtgatcattgttgtgtatgagaagaggaagaggccagatgaggttcctgacgatgatgaaccagctggaccaatgaaaaccaactctaccaacaatcacaaagataaaaacttgcgccagagaaacacaaattaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNPTN-IT1, NPTN
-
Short nameNPTN cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameneuroplastin cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetneuroplastin, NPTN and IDBG-21125 and ENSG00000156642 and 27020, cell adhesion molecule binding, Plasma membranes, Nptn and IDBG-172134 and ENSMUSG00000032336 and 20320, BT.45355 and IDBG-645643 and ENSBTAG00000008218 and 540039
-
Gene info
-
Identity
-
Gene
-
Long gene nameNPTN intronic transcript 1
-
Synonyms gene name
- NPTN intronic transcript 1 (non-protein coding)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2013-02-11
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Intronic transcripts
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameneuroplastin
-
Synonyms gene
-
Synonyms gene name
- stromal cell derived factor receptor 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2002-11-21
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Basigin family
- I-set domain containing
-
VEGA ID