FANCD2 cloning plasmid
-
Catalog numberCSB-CL866311HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FANCD2 gene.
-
SpecificationsGene name: FANCD2; Gene ID: 2177; Accession number: BC013582; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 726; Sequence: atggtttccaaaagaagactgtcaaaatctgaggataaagagagcctgacagaagatgcctccaaaaccaggaagcaaccactttccaaaaagacaaagaaatctcatattgctaatgaagttgaagaaaatgacagcatctttgtaaagcttcttaagatatcaggaattattcttaaaacgggagagagtcagaatcaactagctgtggatcaaatagctttccaaaagaagctctttcagaccctgaggagacacccttcctatcccaaaataatagaagaatttgttagtggcctggagtcttacattgaggatgaagacagtttcaggaactgccttttgtcttgtgagcgtctgcaggatgaggaagccagtatgggtgcatcttattctaagagtctcatcaaactgcttctggggattgacatactgcagcctgccattatcaaaaccttatttgagaagttgccagaatatttttttgaaaacaagaacagtgatgaaatcaacatacctcgactcattgtcagtcaactaaaatggcttgacagagttgtggatggcaaggacctcaccaccaagatcatgcagctgatcagtattgctccagagaacctgcagcatgacatcatcaccagcctacctgagatcctaggggattcccagcacgctgatgtggggaaagaactcaggtggataaaccctctgtcatcatctaagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolFANCD2
-
Short nameFANCD2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameFanconi anemia, complementation family D2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetFanconi anemia, complementation group D2, FA-D2 and FA4 and FACD and FAD and FAD2 and FANCD, FANCD2 and IDBG-17539 and ENSG00000144554 and 2177, DNA polymerase binding, nuclei, Fancd2 and IDBG-177677 and ENSMUSG00000034023 and 211651, FANCD2 and IDBG-644629 and ENSBTAG00000010077 and 515845
-
Gene info
-
Identity
-
Gene
-
Long gene nameFA complementation group D2
-
Synonyms gene
-
Synonyms gene name
- Fanconi anemia complementation group D2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1996-01-04
-
Entrez gene record
-
Pubmed identfication
-
Classification
- FA complementation groups
- Armadillo like helical domain containing
-
VEGA ID
-
Locus Specific Databases