BID cloning plasmid

• Catalog number
  CSB-CL002698HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the BID gene.
• Specifications
  Gene name: BID; Gene ID: 637; Accession number: BC022072; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 588; Sequence: atggactgtgaggtcaacaacggttccagcctcagggatgagtgcatcacaaacctactggtgtttggcttcctccaaagctgttctgacaacagcttccgcagagagctggacgcactgggccacgagctgccagtgctggctccccagtgggagggctacgatgagctgcagactgatggcaaccgcagcagccactcccgcttgggaagaatagaggcagattctgaaagtcaagaagacatcatccggaatattgccaggcacctcgcccaggtcggggacagcatggaccgtagcatccctccgggcctggtgaacggcctggccctgcagctcaggaacaccagccggtcggaggaggaccggaacagggacctggccactgccctggagcagctgctgcaggcctaccctagagacatggagaaggagaagaccatgctggtgctggccctgctgctggccaagaaggtggccagtcacacgccgtccttgctccgtgatgtctttcacacaacagtgaactttattaaccagaacctacgcacctacgtgaggagcttagccagaaatgggatggactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  BID   cloning  
• Gene symbol
  BID
• Short name
  BID cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  BH3 interacting domain death a this GO nist cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  BH3 interacting domain death a this GO nist, FP497, BID and IDBG-1050 and ENSG00000015475 and 101929618,637, ubiquitin protein ligase binding, Plasma membranes, Bid and IDBG-184076 and ENSMUSG00000004446 and 12122, BID and IDBG-641320 and ENSBTAG00000013988 and 510373,782484

Gene info

• Identity
  HGNC:1050
• Gene
  BID
• Long gene name
  BH3 interacting domain death agonist
• GenBank acession
  • AF042083
• Locus
  22q11.21
• Discovery year
  1998-04-20
• Entrez gene record
  637
• Pubmed identfication
  • 8918887
  • 9721221
• RefSeq identity
  • NM_197966
• Classification
  • MicroRNA protein coding host genes
  • BCL2 homology region 3 (BH3) only
  • Receptor ligands
• VEGA ID
  OTTHUMG00000150087

Similar products