CETN2 cloning plasmid
-
Catalog numberCSB-CL005265HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CETN2 gene.
-
SpecificationsGene name: CETN2; Gene ID: 1069; Accession number: BC005334; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 519; Sequence: atggcctccaactttaagaaggcaaacatggcatcaagttctcagcgaaaaagaatgagccctaagcctgagcttactgaagagcaaaagcaggagatccgggaagcttttgatcttttcgatgcggatggaactggcaccatagatgttaaagaactgaaggtggcaatgagggccctgggctttgaacccaagaaagaagaaattaagaaaatgataagtgaaattgataaggaagggacaggaaaaatgaactttggtgactttttaactgtgatgacccagaaaatgtctgagaaagatactaaagaagaaatcctgaaagctttcaagctctttgatgatgatgaaactgggaagatttcgttcaaaaatctgaaacgcgtggccaaggagttgggtgagaacctgactgatgaggagctgcaggaaatgattgatgaagctgatcgagatggagatggagaggtcagtgagcaagagttcctgcgcatcatgaaaaagaccagcctctattaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCETN2
-
Short nameCETN2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namecentrin, EF-hand protein, 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetcentrin, EF-hand protein, 2, CALT and CEN2, CETN2 and IDBG-89287 and ENSG00000147400 and 1069, heterotrimeric G-protein binding, Cytoplasm, Cetn2 and IDBG-151407 and ENSMUSG00000031347 and 26370, CETN2 and IDBG-631952 and ENSBTAG00000007844 and 508601
-
Gene info
-
Identity
-
Gene
-
Long gene namecentrin 2
-
Synonyms gene
-
Synonyms gene name
- centrin, EF-hand protein, 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1997-03-21
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- EF-hand domain containing
- Nucleotide excision repair
- Transcription and export complex 2
-
VEGA ID