ICA1 cloning plasmid
-
Catalog numberCSB-CL010947HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ICA1 gene.
-
SpecificationsGene name: ICA1; Gene ID: 3382; Accession number: BC005922; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1026; Sequence: atgtcaggacacaaatgcagttatccctgggacttacaggatcgatatgctcaagataagtcagttgtaaataagatgcaacagaaatattgggagacgaagcaggcctttattaaagccacagggaagaaggaagatgaacatgttgttgcctctgacgcggacctggatgccaagctagagctgtttcattcaattcagagaacctgtctggacttatcgaaagcaattgtactctatcaaaagaggatatgtttcttgtctcaagaagaaaacgaactgggaaaatttcttcgatcccaaggtttccaagataaaaccagagcaggaaagatgatgcaagcgacaggaaaggccctctgcttttcttcccagcaaaggttggccttacgaaatcctttgtgtcgatttcaccaagaagtggagacttttcggcatcgggccatctcagatacttggctgacggtgaaccgcatggaacagtgcaggacggaatatagaggagcactattatggatgaaggacgtgtctcaggagcttgatccagacctctacaagcaaatggagaagttcaggaaggtacaaacacaagtgcgccttgcaaaaaaaaactttgacaaattgaagatggatgtttgtcaaaaagtggatcttcttggagcgagcagatgcaatctcttgtctcacatgctagcaacataccagaccactctgcttcatttttgggagaaaacttctcacactatggcagccatccatgagagtttcaaaggttatcaaccatatgaatttactactttaaaggtatggaagctagaggggccactagaaaatcttgagaaaagtaaagttttgtttatatcacaagcaaagtccattgcagaaagcatcattattccaggactcagaatgctgaagagagaactgtgcccccagcagagtctttttctttctttctttctttttttttactgcatcaggattcaatacaatgagaatctactgcaatccaaaagcgcgaattga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolICA1-AS1, ICA1
-
Short nameICA1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameislet cell autoantigen 1, 69kDa cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetislet cell autoantigen 1, 69kDa, ICA69 and ICAp69, ICA1 and IDBG-8551 and ENSG00000003147 and 3382, protein domain specific binding, Cell surfaces, Ica1 and IDBG-128452 and ENSMUSG00000062995 and 15893, BT.35115 and IDBG-629525 and ENSBTAG00000000799 and 535346
-
Gene info
-
Identity
-
Gene
-
Long gene nameICA1 antisense RNA 1
-
Locus
-
Discovery year2021-06-09
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameislet cell autoantigen 1
-
Synonyms gene name
- islet cell autoantigen 1 (69kD)
- islet cell autoantigen 1, 69kDa
-
Synonyms
-
Locus
-
Discovery year1992-08-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- AH domain containing
-
VEGA ID