ASGR2 cloning plasmid
-
Catalog numberCSB-CL002208HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ASGR2 gene.
-
SpecificationsGene name: ASGR2; Gene ID: 433; Accession number: BC017251; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 864; Sequence: atggccaaggactttcaagatatccagcagctgagctcggaggaaaatgaccatcctttccatcaagggccacctcctgcccagcccctggcacagcgtctctgctccatggtctgcttcagtctgcttgccctgagcttcaacatcctgctgctggtggtcatctgtgtgactgggtcccaaagtgcacagctgcaagccgagctgcggagcctgaaggaagctttcagcaacttctcctcgagcaccctgacggaggtccaggcaatcagcacccacggaggcagcgtgggtgacaagatcacatccctaggagccaagctggagaaacagcagcaggacctgaaagcagatcacgatgccctgctcttccatctgaagcacttccccgtggacctgcgcttcgtggcctgccagatggagctcctccacagcaacggctcccaaaggacctgctgccccgtcaactgggtggagcaccaaggcagctgctactggttctctcactccgggaaggcctgggctgaggcggagaagtactgccagctggagaacgcacacctggtggtcatcaactcctgggaggagcagaaattcattgtacaacacacgaaccccttcaatacctggataggtctcacggacagtgatggctcttggaaatgggtggatggcacagactataggcacaactacaagaactgggctgtcactcagccagataattggcacgggcacgagctgggtggaagtgaagactgtgttgaagtccagccggatggccgctggaacgatgacttctgcctgcaggtgtaccgctgggtgtgtgagaaaaggcggaatgccaccggcgaggtggcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolASGR2
-
Short nameASGR2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameasialoglycoprotein receptor 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetasialoglycoprotein receptor 2, ASGP-R2 and ASGPR2 and CLEC4H2 and HBXBP and HL-2, ASGR2 and IDBG-23219 and ENSG00000161944 and 433, carbohydrate binding, Plasma membranes, Asgr2 and IDBG-193500 and ENSMUSG00000040963 and 11890, BT.18330 and IDBG-634565 and ENSBTAG00000025101 and 531519
-
Gene info
-
Identity
-
Gene
-
Long gene nameasialoglycoprotein receptor 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1988-05-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C-type lectin domain containing
-
VEGA ID