BIRC5 cloning plasmid
-
Catalog numberCSB-CL002706HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BIRC5 gene.
-
SpecificationsGene name: BIRC5; Gene ID: 332; Accession number: BC008718; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 429; Sequence: atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttcttctgcttcaaggagctggaaggctgggagccagatgacgaccccatagaggaacataaaaagcattcgtccggttgcgctttcctttctgtcaagaagcagtttgaagaattaacccttggtgaatttttgaaactggacagagaaagagccaagaacaaaattgcaaaggaaaccaacaataagaagaaagaatttgaggaaactgcgaagaaagtgcgccgtgccatcgagcagctggctgccatggattga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBIRC5
-
Short nameBIRC5 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namebaculoviral IAP repeat containing 5 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetbaculoviral IAP repeat containing 5, API4 and EPR-1, BIRC5 and IDBG-70554 and ENSG00000089685 and 332, chaperone binding, nuclei, Birc5 and IDBG-214593 and ENSMUSG00000017716 and 11799, BIRC5 and IDBG-642915 and ENSBTAG00000013573 and 414925
-
Gene info
-
Identity
-
Gene
-
Long gene namebaculoviral IAP repeat containing 5
-
Synonyms gene
-
Synonyms gene name
- apoptosis inhibitor 4
- baculoviral IAP repeat-containing 5
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1998-06-10
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Baculoviral IAP repeat containing
- Chromosomal passenger complex
-
VEGA ID