PRDX2 cloning plasmid
-
Catalog numberCSB-CL339235HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PRDX2 gene.
-
SpecificationsGene name: PRDX2; Gene ID: 7001; Accession number: BC064138; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 429; Sequence: atggcctccggtaacgcgcgcatcggaaagccagcccctgacttcaaggccacagcggtggttgatggcgccttcaaagaggtgaagctgtcggactacaaagggaagtacgtggtcctctttttctaccctctggacttcacttttgtgtgccccaccgagatcatcgcgttcagcaaccgtgcagaggacttccgcaagctgggctgtgaagtgctgggcgtctcggtggactctcagttcacccacctggcttggtatgagcaggggccaaagagggaggttgcagctaagctcacaccctcaggtcctagcagtgtggcttcgtggccattgctcaacctctggaacctgcgtttccccatcgtgaaaataatggaaacattgccgcccaagtctttaaggatgatgacagtaattagcatttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPRDX2
-
Short namePRDX2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameperoxiredoxin 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetperoxiredoxin 2, HEL-S-2a and NKEF-B and NKEFB and PRP and PRX2 and PRXII and PTX1 and TDPX1 and TPX1 and TSA, PRDX2 and IDBG-31024 and ENSG00000167815 and 7001, peroxiredoxin activity, Cytoplasm, PRDX2 and IDBG-642937 and ENSBTAG00000012062 and 286793
-
Gene info
-
Identity
-
Gene
-
Long gene nameperoxiredoxin 2
-
Synonyms gene
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year1995-07-06
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Peroxiredoxins
-
VEGA ID