PHLDA2 cloning plasmid
-
Catalog numberCSB-CL687493HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PHLDA2 gene.
-
SpecificationsGene name: PHLDA2; Gene ID: 7262; Accession number: BC005034; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 459; Sequence: atgaaatcccccgacgaggtgctacgcgagggcgagttggagaagcgcagcgacagcctcttccagctatggaagaagaagcgcggggtgctcacctccgaccgcctgagcctgttccccgccagcccccgcgcgcgccccaaggagctgcgcttccactccatcctcaaggtggactgcgtggagcgcacgggcaagtacgtgtacttcaccatcgtcaccaccgaccacaaggagatcgacttccgctgcgcgggcgagagctgctggaacgcggccatcgcgctggcgctcatcgatttccagaaccgccgcgccctgcaggactttcgcagccgccaggaacgcaccgcacccgccgcacccgccgaggacgccgtggctgccgcggccgccgcaccctccgagccctcggagccctccaggccatccccgcagcccaaaccccgcacgccatga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPHLDA2
-
Short namePHLDA2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namepleckstrin homology-like domain, family A, member 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetpleckstrin homology-like domain, family A, member 2, BRW1C and BWR1C and HLDA2 and IPL and TSSC3, PHLDA2 and IDBG-23772 and ENSG00000181649 and 7262, Plasma membranes, Phlda2 and IDBG-212749 and ENSMUSG00000010760 and 22113, PHLDA2 and IDBG-645159 and ENSBTAG00000031194 and 618810
-
Gene info
-
Identity
-
Gene
-
Long gene namepleckstrin homology like domain family A member 2
-
Synonyms gene
-
Synonyms gene name
- tumor suppressing subtransferable candidate 3
- pleckstrin homology-like domain, family A, member 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-06-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Pleckstrin homology domain containing
-
VEGA ID
-
Locus Specific Databases