TUBB cloning plasmid
-
Catalog numberCSB-CL025318HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TUBB gene.
-
SpecificationsGene name: TUBB; Gene ID: 203068; Accession number: BC062532; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 375; Sequence: atgtccatgaaggaggtcgatgagcagatgcttaacgtgcagaacaagaacagcagctactttgtggaatggatccccaacaatgtcaagacagccgtctgtgacatcccacctcgtggcctcaagatggcagtcaccttcattggcaatagcacagccatccaggagctcttcaagcgcatctcggagcagttcactgccatgttccgccggaaggccttcctccactggtacacaggcgagggcatggacgagatggagttcaccgaggctgagagcaacatgaacgacctcgtctctgagtatcagcagtaccaggatgccaccgcagaagaggaggaggatttcggtgaggaggccgaagaggaggcctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTUBB2A, TUBB
-
Short nameTUBB cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametubulin, b class I cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettubulin, beta class I, TUBB and IDBG-76778 and ENSG00000196230 and 203068, MHC class I protein binding, nuclei, Tubb5 and IDBG-179144 and ENSMUSG00000001525 and 22154, TUBB5 and IDBG-634521 and ENSBTAG00000006969 and 533307,615087
-
Gene info
-
Identity
-
Gene
-
Long gene nametubulin beta 2A class IIa
-
Synonyms gene
-
Synonyms gene name
- tubulin, beta polypeptide
- tubulin, beta 2
- tubulin, beta 2A
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Tubulins
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nametubulin beta class I
-
Synonyms gene name
- tubulin, beta polypeptide
- tubulin, beta
- tubulin, beta class I
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-11-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Tubulins
-
VEGA ID